Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__32652446_10
          See other MID2 GT Assays ›
          SNP ID:
          rs7885256
          Gene
          MID2
          Gene Name
          midline 2
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.X: 107839734 - 107839734 on Build GRCh38
          Polymorphism:
          A/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          GGTTACCAGATCTTAAAATTTCTGG[A/C]ACTTTGCTAATTTCTATCTAGATAT

          Assay ID C__32652446_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 300204

          Literature Links:

          MID2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.21)
          (0.79)
          Caucasian - Not Available CEPH (CEU)
          C (0.14)
          (0.86)
          EAS
          C (0.10)
          (0.90)
          African American - Not Available YRI (Yoruba)
          A (0.32)
          (0.68)
          SAS
          C (0.09)
          (0.91)
          Chinese - Not Available JPT (Japanese)
          C (0.15)
          (0.85)
          AFR
          A (0.48)
          (0.52)
          Japanese - Not Available CHB (Han Chinese)
          C (0.17)
          (0.83)
          EUR
          C (0.11)
          (0.89)
          AMR
          C (0.10)
          (0.90)
          MID2 - midline 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_012216.3 Intron NP_036348.2
          NM_052817.2 Intron NP_438112.2
          XM_005262062.4 Intron XP_005262119.1
          XM_017029239.1 Intron XP_016884728.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          ubiquitin-protein ligase

          Gene Ontology Categories:

          Function(s) Process(es)

          positive regulation of autophagy
          protein ubiquitination
          negative regulation of viral transcription
          protein localization to microtubule
          positive regulation of I-kappaB kinase/NF-kappaB signaling
          innate immune response
          negative regulation of viral entry into host cell
          positive regulation of sequence-specific DNA binding transcription factor activity
          positive regulation of NF-kappaB transcription factor activity
          negative regulation of viral release from host cell
          microtubule binding
          zinc ion binding
          ligase activity
          protein homodimerization activity
          protein heterodimerization activity
          phosphoprotein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          • Price & Freight Policy
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • German Supply Chain Due Diligence Act
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Legal Notice
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-7d94cb4b65-6wvps:80/100.66.75.98:80.
          git-commit: c9e08c96761173abe34e68f880379696776a4827
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.44.1-2026.02.97.1.0