Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__33828878_10
          See other CSTF2T GT Assays ›
          SNP ID:
          rs16921605
          Gene
          CSTF2T PRKG1
          Gene Name
          cleavage stimulation factor subunit 2, tau variant
          protein kinase, cGMP-dependent, type I
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.10: 51696102 - 51696102 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          ATGTATATTAGGACTAAATGGCTGT[A/G]TTCCATGCAAAAAGTAAAATGAGCA

          Assay ID C__33828878_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 611968 MIM: 176894

          Literature Links:

          CSTF2T PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.09)
          (0.91)
          Caucasian - Not Available CEPH (CEU)
          G (0.12)
          (0.88)
          EAS
          G (0.08)
          (0.92)
          African American - Not Available YRI (Yoruba)
          G (0.17)
          (0.83)
          SAS
          G (0.09)
          (0.91)
          Chinese - Not Available JPT (Japanese)
          G (0.09)
          (0.91)
          AFR
          G (0.15)
          (0.85)
          Japanese - Not Available CHB (Han Chinese)
          G (0.13)
          (0.87)
          EUR
          G (0.08)
          (0.92)
          AMR
          G (0.06)
          (0.94)
          CSTF2T - cleavage stimulation factor subunit 2, tau variant
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_015235.2 3494 UTR 3 NP_056050.1
          PRKG1 - protein kinase, cGMP-dependent, type I
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001098512.2 3494 Intron NP_001091982.1
          NM_006258.3 3494 Intron NP_006249.1
          XM_011539952.2 3494 Intron XP_011538254.1
          XM_017016412.1 3494 Intron XP_016871901.1
          XM_017016413.1 3494 Intron XP_016871902.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          mRNA polyadenylation factor non-receptor serine/threonine protein kinase

          Gene Ontology Categories:

          Function(s) Process(es)

          pre-mRNA cleavage required for polyadenylation
          neuron migration
          protein phosphorylation
          signal transduction
          dendrite development
          cGMP-mediated signaling
          actin cytoskeleton organization
          forebrain development
          regulation of GTPase activity
          relaxation of vascular smooth muscle
          negative regulation of platelet aggregation
          mitophagy in response to mitochondrial depolarization
          nucleotide binding
          mRNA binding
          protein binding
          poly(A) RNA binding
          protein serine/threonine kinase activity
          cGMP-dependent protein kinase activity
          calcium channel regulator activity
          ATP binding
          cGMP binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline