Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__43523189_10
          See other EIF2AK4 GT Assays ›
          SNP ID:
          rs7179904
          Gene
          EIF2AK4 SRP14 SRP14-AS1
          Gene Name
          eukaryotic translation initiation factor 2 alpha kinase 4
          signal recognition particle 14
          SRP14 antisense RNA1 (head to head)
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.15: 40036517 - 40036517 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TGAATAAGCCTGAAAGATACAACAG[A/G]GCATACCTTAGTGGGAAGATGTGCA

          Assay ID C__43523189_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 609280 MIM: 600708

          Literature Links:

          EIF2AK4 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.02)
          (0.98)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          G (0.04)
          (0.96)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          G (0.00)
          (1.00)
          Chinese - Not Available JPT (Japanese)
          G (0.02)
          (0.98)
          AFR
          G (0.01)
          (0.99)
          Japanese - Not Available CHB (Han Chinese)
          G (0.06)
          (0.94)
          EUR
          G (0.00)
          (1.00)
          AMR
          G (0.03)
          (0.97)
          EIF2AK4 - eukaryotic translation initiation factor 2 alpha kinase 4
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001013703.3 Intron NP_001013725.2
          XM_005254392.2 Intron XP_005254449.1
          XM_011521599.2 Intron XP_011519901.1
          XM_011521600.2 Intron XP_011519902.1
          XM_017022219.1 Intron XP_016877708.1
          SRP14 - signal recognition particle 14
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001309434.1 Intron NP_001296363.1
          NM_003134.5 Intron NP_003125.3
          SRP14-AS1 - SRP14 antisense RNA1 (head to head)
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          non-receptor serine/threonine protein kinase RNA metabolism protein

          Gene Ontology Categories:

          Function(s) Process(es)

          positive regulation of defense response to virus by host
          adaptive immune response
          T cell activation involved in immune response
          positive regulation of adaptive immune response
          regulation of translational initiation
          protein phosphorylation
          cell cycle arrest
          learning
          long-term memory
          regulation of translational initiation by eIF2 alpha phosphorylation
          viral translation
          negative regulation of translational initiation in response to stress
          negative regulation of CREB transcription factor activity
          cellular response to amino acid starvation
          cellular response to UV
          eiF2alpha phosphorylation in response to endoplasmic reticulum stress
          induction by virus of host autophagy
          negative regulation by host of viral genome replication
          negative regulation of neuron differentiation
          negative regulation of translational initiation
          protein autophosphorylation
          defense response to virus
          regulation of feeding behavior
          regulation of eIF2 alpha phosphorylation by amino acid starvation
          cellular response to cold
          positive regulation of translational initiation in response to starvation
          positive regulation of long-term synaptic potentiation
          neuron projection extension
          cellular response to leucine starvation
          cotranslational protein targeting to membrane
          SRP-dependent cotranslational protein targeting to membrane
          response to drug
          protein targeting to ER
          tRNA binding
          protein serine/threonine kinase activity
          eukaryotic translation initiation factor 2alpha kinase activity
          ATP binding
          RNA binding
          protein binding
          7S RNA binding
          endoplasmic reticulum signal peptide binding
          poly(A) RNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-9fm2r:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline