Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__43628507_10
          See other ABCC11 GT Assays ›
          SNP ID:
          rs9934484
          Gene
          ABCC11 LONP2
          Gene Name
          ATP binding cassette subfamily C member 11
          lon peptidase 2, peroxisomal
          Set Membership:
          -
          Chromosome Location:
          Chr.16: 48247395 - 48247395 on Build GRCh38
          Polymorphism:
          G/A, Transition substitution
          Context Sequence [VIC/FAM]:

          GTTTCCTTTGCGCTATCCAGGTGAC[G/A]CTGGCACAGCCTTCAAAGAGCAGCA

          Assay ID C__43628507_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 607040

          Literature Links:

          ABCC11 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          ABCC11 - ATP binding cassette subfamily C member 11
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_032583.3 2579 Intron NP_115972.2
          NM_033151.3 2579 Intron NP_149163.2
          NM_145186.2 2579 Intron NP_660187.1
          XM_011523397.1 2579 Intron XP_011521699.1
          XM_011523398.2 2579 Intron XP_011521700.1
          XM_017023795.1 2579 UTR 5 XP_016879284.1
          XM_017023796.1 2579 Intron XP_016879285.1
          XM_017023797.1 2579 Intron XP_016879286.1
          XM_017023798.1 2579 Intron XP_016879287.1
          XM_017023799.1 2579 Intron XP_016879288.1
          XM_017023800.1 2579 Intron XP_016879289.1
          XM_017023801.1 2579 UTR 5 XP_016879290.1
          XM_017023802.1 2579 Intron XP_016879291.1
          XM_017023803.1 2579 UTR 5 XP_016879292.1
          LONP2 - lon peptidase 2, peroxisomal
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001300948.1 2579 Intron NP_001287877.1
          NM_031490.3 2579 Intron NP_113678.2
          XM_017023755.1 2579 Intron XP_016879244.1
          XM_017023756.1 2579 Intron XP_016879245.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          ATP-binding cassette (ABC) transporter serine protease

          Gene Ontology Categories:

          Function(s) Process(es)

          organic anion transport
          purine nucleotide transport
          transmembrane transport
          anion transmembrane transport
          misfolded or incompletely synthesized protein catabolic process
          protein targeting to peroxisome
          peroxisome organization
          response to organic cyclic compound
          protein processing
          protein import into peroxisome matrix
          regulation of fatty acid beta-oxidation
          ATP binding
          organic anion transmembrane transporter activity
          purine nucleotide transmembrane transporter activity
          anion transmembrane-transporting ATPase activity
          protease binding
          ATP-dependent peptidase activity
          serine-type endopeptidase activity
          receptor binding
          protein binding
          peptidase activity
          enzyme binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-8ltcg:80/100.66.77.141:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline