Hamburger Menu Button
Thermo Fisher Scientific Logo
Faça o login
Não tem uma conta? Criar Conta​
  • Produtos
    • Consumíveis de Laboratório
    • Equipamentos de Laboratório
    • Instrumentos de Laboratório
    • Clínica & Diagnóstico
    • Cromatografia
    • Espectrômetria de Massas
    • Cultura Celular
    • Análise Celular
    • Anticorpos
    • Biologia Molecular & Análise de Ácidos Nucleicos
    • Produtos Ácidos Nucleicos Específicos de Sequência
    • Veja todas as categorias de produtos
  • Aplicações
    • Cultura Celular e Transfecção
    • Citometria de Fluxo
    • Pesquisa em Oncologia
    • Cromatografia
    • Sequenciamento
    • PCR
    • Soluções Laboratoriais
    • Diagnóstico de Alergias
    • Veja todas as aplicações e técnicas
  • Serviços
    • Serviços de Instrumentos e Equipamentos de Laboratório
    • Serviços Personalizados
    • Serviços de Treinamento
    • Informática de Laboratório em Nível Empresarial
    • Serviços Financeiros e de Arrendamento
    • CDMO & Serviços de Ensaios Clínicos
    • Veja todas as serviços
  • Ajuda e suporte
    • Cadastre-se em nosso site
    • Como fazer o pedido
    • Entre em Contato Conosco
    • Mudança de Localização do Site
    • Veja todos os tópicos de ajuda e suporte
  • Popular
    • Our Instagram
      Nosso Instagram
    • Our Facebook
      Nosso Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Quem atendemos
    • Setor de Biotecnologia
    • Indústria Biofarmacêutica
    • CDMO
    • Diagnósticos Laboratoriais
    • Ciência Industrial e Aplicada
  • Ofertas especiais
  • Fale Conosco
  • Pedido rápido
  • Documentos e certificados
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Fale Conosco
          • Pedido rápido
          • Faça o login
            Faça o login
            Não tem uma conta? Criar Conta​
            • Conta
            • Status do pedido
            • Produtos Customizados & Projetos
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__44202997_20
          See other GSTM1 GT Assays ›
          SNP ID:
          rs1065411
          Gene
          GSTM1 GSTM2
          Gene Name
          glutathione S-transferase mu 1
          glutathione S-transferase mu 2 (muscle)
          Set Membership:
          > DME > Validated > Inventoried
          Chromosome Location:
          Chr.1: 109690516 - 109690516 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          ACCTCCACCGTATATTTGAGCCCAA[C/G]TGCTTGGACGCCTTCCCAAATCTGA

          Assay ID C__44202997_20
          Size 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          26 submissions

          Phenotype:

          MIM: 138350 MIM: 138380

          Literature Links:

          GSTM1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian
          C (0.32)
          (0.68)
          CEPH (CEU) - Not Available
          EAS - Not Available African American
          C (0.07)
          (0.93)
          YRI (Yoruba) - Not Available
          SAS - Not Available Japanese
          G (0.28)
          (0.72)
          CHB (Han Chinese) - Not Available
          AFR - Not Available Chinese
          G (0.42)
          (0.58)
          JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          GSTM1 - glutathione S-transferase mu 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000561.3 Intron NP_000552.2
          NM_146421.2 Intron NP_666533.1
          XM_005270782.4 Intron XP_005270839.1
          GSTM2 - glutathione S-transferase mu 2 (muscle)
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Additional Information:

          The GSTM1 gene exhibits copy number variation. Individuals may carry GSTM1 deletion alleles. GSTM1 SNP genotyping assays run samples having no GSTM1 genes will not amplify, and samples having 1 gene copy will cluster with one of the homozygous clusters. For accurate GSTM1 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.

          Set Membership:

          DME Validated Inventoried

          Panther Classification:

          Molecular Function -

          transferase

          Gene Ontology Categories:

          Function(s) Process(es)

          glutathione metabolic process
          nitrobenzene metabolic process
          xenobiotic catabolic process
          cellular detoxification of nitrogen compound
          glutathione derivative biosynthetic process
          glutathione transferase activity
          enzyme binding
          protein homodimerization activity
          glutathione binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Status do pedido
          • Ajuda para pedidos
          • Pedido rápido
          • Supply Center
          • eProcurement
          Suporte Plus Icon Minus Icon
          • Ajuda e suporte
          • Entre em Contato
          • Centros de Suporte Técnico
          • Obter Documentos e Certificados
          • Informe um Problema no Site
          Recursos Plus Icon Minus Icon
          • Centros de aprendizagem
          • Promoções
          • Eventos & Webinars
          • Mídia Sociais
          Sobre a Thermo Fisher Plus Icon Minus Icon
          • Sobre Nós Sobre Nós
          • Carreiras Carreiras
          • Investidores Investidores
          • Sala de Impresa Sala de Impresa
          • Responsabilidade Social Responsabilidade Social
          • Marcas
          • Políticas e avisos
          Nosso Portfólio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-b2k9d:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline