Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__57466797_20
          See other KLHL17 GT Assays ›
          SNP ID:
          rs3935066
          Gene
          KLHL17 NOC2L PERM1 PLEKHN1
          Gene Name
          kelch like family member 17
          NOC2 like nucleolar associated transcriptional repressor
          PPARGC1 and ESRR induced regulator, muscle 1
          pleckstrin homology domain containing N1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.1: 965350 - 965350 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TTAGTTATTTATCTTATTTATTGAG[A/G]GGTGAGGAGTGCCACGGCTGCCCGT

          Assay ID C__57466797_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          36 submissions

          Phenotype:

          MIM: 610770 MIM: 615921

          Literature Links:

          KLHL17 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.35)
          (0.65)
          Caucasian - Not Available CEPH (CEU)
          C (0.08)
          (0.92)
          EAS
          C (0.29)
          (0.71)
          African American - Not Available YRI (Yoruba)
          T (0.15)
          (0.85)
          SAS
          C (0.12)
          (0.88)
          Chinese - Not Available JPT (Japanese)
          C (0.35)
          (0.65)
          AFR
          T (0.20)
          (0.80)
          Japanese - Not Available CHB (Han Chinese)
          C (0.33)
          (0.67)
          EUR
          C (0.09)
          (0.91)
          AMR
          C (0.29)
          (0.71)
          KLHL17 - kelch like family member 17
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_198317.2 2748 UTR 3 NP_938073.1
          XM_006710600.3 2748 UTR 3 XP_006710663.1
          XM_006710601.3 2748 Intron XP_006710664.1
          NOC2L - NOC2 like nucleolar associated transcriptional repressor
          There are no transcripts associated with this gene.
          PERM1 - PPARGC1 and ESRR induced regulator, muscle 1
          There are no transcripts associated with this gene.
          PLEKHN1 - pleckstrin homology domain containing N1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001160184.1 2748 Intron NP_001153656.1
          NM_032129.2 2748 Intron NP_115505.2
          XM_006710944.3 2748 Intron XP_006711007.2
          XM_011542248.2 2748 Intron XP_011540550.2
          XM_017002474.1 2748 Intron XP_016857963.1
          XM_017002475.1 2748 Intron XP_016857964.1
          XM_017002476.1 2748 Intron XP_016857965.1
          XM_017002477.1 2748 Intron XP_016857966.1
          XM_017002478.1 2748 Intron XP_016857967.1
          XM_017002479.1 2748 Intron XP_016857968.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          scaffold/adaptor protein

          Gene Ontology Categories:

          Function(s) Process(es)

          brain development
          protein ubiquitination
          actin cytoskeleton organization
          ubiquitin-protein transferase activity
          POZ domain binding
          protein complex scaffold
          actin filament binding
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Spain flag icon
          Spain

          TEST

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-knt4q:80/100.66.75.14:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0