Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__58178222_10
          See other GRK4 GT Assays ›
          SNP ID:
          rs1140085
          Gene
          GRK4
          Gene Name
          G protein-coupled receptor kinase 4
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.4: 3013826 - 3013826 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TCTGGAGAAAGTGCAAAGTAGATTC[A/G]TAGTAAGTGTCTCCTCTTAGTCTTC

          Assay ID C__58178222_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 137026

          Literature Links:

          GRK4 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.04)
          (0.96)
          Caucasian - Not Available CEPH (CEU)
          A (0.16)
          (0.84)
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.01)
          (0.99)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.01)
          (0.99)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.15)
          (0.85)
          AMR
          A (0.06)
          (0.94)
          GRK4 - G protein-coupled receptor kinase 4
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001004056.1 681 Missense Mutation ATA,GTA I,V 215 NP_001004056.1
          NM_001004057.1 681 Missense Mutation ATA,GTA I,V 247 NP_001004057.1
          NM_005307.2 681 Missense Mutation ATA,GTA I,V 215 NP_005298.2
          NM_182982.2 681 Missense Mutation ATA,GTA I,V 247 NP_892027.2
          XM_005247962.3 681 Missense Mutation ATA,GTA I,V 36 XP_005248019.1
          XM_006713880.3 681 Missense Mutation ATA,GTA I,V 36 XP_006713943.1
          XM_011513447.2 681 Missense Mutation ATA,GTA I,V 286 XP_011511749.1
          XM_011513448.2 681 Missense Mutation ATA,GTA I,V 286 XP_011511750.1
          XM_011513449.2 681 Missense Mutation ATA,GTA I,V 254 XP_011511751.1
          XM_011513450.2 681 Missense Mutation ATA,GTA I,V 286 XP_011511752.1
          XM_011513451.2 681 Missense Mutation ATA,GTA I,V 286 XP_011511753.1
          XM_011513452.2 681 Missense Mutation ATA,GTA I,V 286 XP_011511754.1
          XM_011513453.2 681 Missense Mutation ATA,GTA I,V 286 XP_011511755.1
          XM_011513454.2 681 Missense Mutation ATA,GTA I,V 286 XP_011511756.1
          XM_011513455.2 681 Missense Mutation ATA,GTA I,V 286 XP_011511757.1
          XM_011513456.2 681 Missense Mutation ATA,GTA I,V 286 XP_011511758.1
          XM_011513457.2 681 Missense Mutation ATA,GTA I,V 286 XP_011511759.1
          XM_017008052.1 681 Missense Mutation ATA,GTA I,V 260 XP_016863541.1
          XM_017008053.1 681 Missense Mutation ATA,GTA I,V 286 XP_016863542.1
          XM_017008054.1 681 Missense Mutation ATA,GTA I,V 247 XP_016863543.1
          XM_017008055.1 681 Missense Mutation ATA,GTA I,V 215 XP_016863544.1
          XM_017008056.1 681 Missense Mutation ATA,GTA I,V 247 XP_016863545.1
          XM_017008057.1 681 Missense Mutation ATA,GTA I,V 53 XP_016863546.1
          XM_017008058.1 681 Missense Mutation ATA,GTA I,V 53 XP_016863547.1
          XM_017008059.1 681 Missense Mutation ATA,GTA I,V 53 XP_016863548.1
          XM_017008060.1 681 Missense Mutation ATA,GTA I,V 53 XP_016863549.1
          XM_017008061.1 681 Missense Mutation ATA,GTA I,V 36 XP_016863550.1
          XM_017008062.1 681 Missense Mutation ATA,GTA I,V 36 XP_016863551.1
          XM_017008063.1 681 Missense Mutation ATA,GTA I,V 53 XP_016863552.1
          XM_017008064.1 681 Missense Mutation ATA,GTA I,V 53 XP_016863553.1
          XM_017008065.1 681 Missense Mutation ATA,GTA I,V 286 XP_016863554.1
          XM_017008066.1 681 Missense Mutation ATA,GTA I,V 53 XP_016863555.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          non-receptor serine/threonine protein kinase

          Gene Ontology Categories:

          Function(s) Process(es)

          G-protein coupled receptor internalization
          protein phosphorylation
          signal transduction
          regulation of G-protein coupled receptor protein signaling pathway
          regulation of rhodopsin mediated signaling pathway
          receptor internalization
          G-protein coupled receptor kinase activity
          ATP binding
          rhodopsin kinase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Spain flag icon
          Spain

          TEST

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-b2k9d:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline