Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGAACTACTGGCCTCTGACCCCAC[C/T]CAGCAAGGCCCTACCGTGCTCAGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 140572 MIM: 604548 MIM: 610788 | ||||||||||||||||||||
Literature Links: |
HSP90AB1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HSP90AB1 - heat shock protein 90 alpha family class B member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4647 - microRNA 4647 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NFKBIE - NFKB inhibitor epsilon | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004556.2 | 2197 | UTR 3 | NP_004547.2 |
SLC35B2 - solute carrier family 35 member B2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286509.1 | 2197 | Intron | NP_001273438.1 | |||
NM_001286510.1 | 2197 | Intron | NP_001273439.1 | |||
NM_001286511.1 | 2197 | Intron | NP_001273440.1 | |||
NM_001286512.1 | 2197 | Intron | NP_001273441.1 | |||
NM_001286513.1 | 2197 | Intron | NP_001273442.1 | |||
NM_001286517.1 | 2197 | Intron | NP_001273446.1 | |||
NM_001286519.1 | 2197 | Intron | NP_001273448.1 | |||
NM_001286520.1 | 2197 | Intron | NP_001273449.1 | |||
NM_178148.3 | 2197 | Intron | NP_835361.1 |