Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
TGGGGAGGAGTGAGCCCTGGGAGGG[A/G]AAAGGGAAAGAAAGGCAGGGGTCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609336 MIM: 616808 | ||||||||||||||||||||
Literature Links: |
ANGPTL6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANGPTL6 - angiopoietin like 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C19orf66 - chromosome 19 open reading frame 66 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001308277.1 | Intron | NP_001295206.1 | ||||
NM_018381.3 | Intron | NP_060851.2 | ||||
XM_011528121.1 | Intron | XP_011526423.1 | ||||
XM_011528122.1 | Intron | XP_011526424.1 | ||||
XM_017026934.1 | Intron | XP_016882423.1 |