Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__61261719_10
          See other ASCC2 GT Assays ›
          SNP ID:
          rs28544456
          Gene
          ASCC2
          Gene Name
          activating signal cointegrator 1 complex subunit 2
          Set Membership:
          -
          Chromosome Location:
          Chr.22: 29789057 - 29789057 on Build GRCh38
          Polymorphism:
          A/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          TTGCTCCTCTTGCGGTCGGCCATGG[A/T]TCTCCGGTTGTGGTTGGCTCTTGTC

          Assay ID C__61261719_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 614216

          Literature Links:

          ASCC2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          ASCC2 - activating signal cointegrator 1 complex subunit 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001242906.1 2414 Missense Mutation ACC,TCC T,S 668 NP_001229835.1
          NM_032204.4 2414 Missense Mutation ACC,TCC T,S 744 NP_115580.2
          XM_005261775.2 2414 Missense Mutation ACC,TCC T,S 744 XP_005261832.1
          XM_011530442.2 2414 Missense Mutation ACC,TCC T,S 749 XP_011528744.1
          XM_011530443.2 2414 Missense Mutation ACC,TCC T,S 749 XP_011528745.1
          XM_011530444.2 2414 Missense Mutation ACC,TCC T,S 749 XP_011528746.1
          XM_011530445.2 2414 Missense Mutation ACC,TCC T,S 749 XP_011528747.1
          XM_011530446.2 2414 Missense Mutation ACC,TCC T,S 749 XP_011528748.1
          XM_011530448.2 2414 Missense Mutation ACC,TCC T,S 696 XP_011528750.1
          XM_011530449.2 2414 Missense Mutation ACC,TCC T,S 696 XP_011528751.1
          XM_011530450.2 2414 Missense Mutation ACC,TCC T,S 635 XP_011528752.1
          XM_011530451.2 2414 Missense Mutation ACC,TCC T,S 635 XP_011528753.1
          XM_011530452.2 2414 Missense Mutation ACC,TCC T,S 635 XP_011528754.1
          XM_011530453.2 2414 Missense Mutation ACC,TCC T,S 635 XP_011528755.1
          XM_011530454.2 2414 Missense Mutation ACC,TCC T,S 635 XP_011528756.1
          XM_011530455.2 2414 Missense Mutation ACC,TCC T,S 635 XP_011528757.1
          XM_017028991.1 2414 Missense Mutation ACC,TCC T,S 803 XP_016884480.1
          XM_017028992.1 2414 Missense Mutation ACC,TCC T,S 798 XP_016884481.1
          XM_017028993.1 2414 Missense Mutation ACC,TCC T,S 778 XP_016884482.1
          XM_017028994.1 2414 Missense Mutation ACC,TCC T,S 773 XP_016884483.1
          XM_017028995.1 2414 Missense Mutation ACC,TCC T,S 750 XP_016884484.1
          XM_017028996.1 2414 Missense Mutation ACC,TCC T,S 749 XP_016884485.1
          XM_017028997.1 2414 Missense Mutation ACC,TCC T,S 745 XP_016884486.1
          XM_017028998.1 2414 Missense Mutation ACC,TCC T,S 744 XP_016884487.1
          XM_017028999.1 2414 Missense Mutation ACC,TCC T,S 744 XP_016884488.1
          XM_017029000.1 2414 Missense Mutation ACC,TCC T,S 744 XP_016884489.1
          XM_017029001.1 2414 Missense Mutation ACC,TCC T,S 691 XP_016884490.1
          XM_017029002.1 2414 Missense Mutation ACC,TCC T,S 691 XP_016884491.1
          XM_017029003.1 2414 Missense Mutation ACC,TCC T,S 691 XP_016884492.1
          XM_017029004.1 2414 Missense Mutation ACC,TCC T,S 666 XP_016884493.1
          XM_017029005.1 2414 Missense Mutation ACC,TCC T,S 630 XP_016884494.1
          XM_017029006.1 2414 Missense Mutation ACC,TCC T,S 630 XP_016884495.1
          XM_017029007.1 2414 Missense Mutation ACC,TCC T,S 630 XP_016884496.1
          XM_017029008.1 2414 Missense Mutation ACC,TCC T,S 630 XP_016884497.1
          XM_017029009.1 2414 Missense Mutation ACC,TCC T,S 630 XP_016884498.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s)

          DNA dealkylation involved in DNA repair
          transcription, DNA-templated
          regulation of transcription, DNA-templated

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-zsnhf:80/100.66.75.14:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline