Search
LOADING 
- SNP ID:
- rs150305552
- Gene
-
KRT40KRTAP3-2KRTAP3-3 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.17: 40994017 - 40994017 on Build GRCh38
- Polymorphism:
- A/G, Transition Substitution
- Context Sequence [VIC/FAM]:
AGGTGCTGGGCAGGCAGACTCCACA[A/G]CGGCAGGATTTGTCAGAGGAGCAGA
Genomic Map
Back To TopAssay 상세 정보
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616679
|
||||||||||||||||||||
Literature Links: |
KRT40 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| KRT40 - keratin 40 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| KRTAP3-2 - keratin associated protein 3-2 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| KRTAP3-3 - keratin associated protein 3-3 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_033185.2 | 117 | Silent Mutation | CGC,CGT | R,R 27 | NP_149441.1 | |
Back To Top추가 정보
Additional Information:
For this assay, SNP(s) [rs1989365] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Ontology Categories:
Back To Top