Search
LOADING 
- SNP ID:
- rs72549354
- Gene
-
CYP2D6LOC102723722NDUFA6-AS1 - Gene Name
- Set Membership:
- > Validated > Inventoried
- Chromosome Location:
- Chr.22: 42128817 - 42128818 on Build GRCh38
- Polymorphism:
- C/-, Insertion/deletion
- Context Sequence [VIC/FAM]:
AAAGCCCGACTCCTCCTTCAGTCCC[C/-]TCCTGAGCTAGGTCCAGCAGCCTGA
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 124030
|
||||||||||||||||||||||||||||||||
Literature Links: |
CYP2D6 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
CYP2D6*20,g.1973_1974insG
|
||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap | |||
|---|---|---|---|---|---|
| Global - Not Available | Caucasian
|
CEPH (CEU) - Not Available | |||
| EAS - Not Available | African American
|
YRI (Yoruba) - Not Available | |||
| SAS - Not Available | Japanese
|
CHB (Han Chinese) - Not Available | |||
| AFR - Not Available | Chinese
|
JPT (Japanese) - Not Available | |||
| EUR - Not Available | |||||
| AMR - Not Available |
| CYP2D6 - cytochrome P450 family 2 subfamily D member 6 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_000106.5 | 569 | Frame Shift InDel | GAG,GGA | E,G 211 | NP_000097.3 | |
| NM_001025161.2 | 569 | Frame Shift InDel | GAG,GGA | E,G 160 | NP_001020332.2 | |
| XM_011529966.2 | 569 | Intron | XP_011528268.1 | |||
| XM_011529968.2 | 569 | Intron | XP_011528270.1 | |||
| XM_011529970.2 | 569 | Intron | XP_011528272.1 | |||
| XM_011529972.2 | 569 | Intron | XP_011528274.1 | |||
| LOC102723722 - uncharacterized LOC102723722 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| XM_017029174.1 | 569 | Intron | XP_016884663.1 | |||
| NDUFA6-AS1 - NDUFA6 antisense RNA 1 (head to head) | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To TopMore Information
Important Information
C__72649949_10 does not map to human assembly B38. Assay C__72649949_60 targets CYP2D6*20, g.1973_1974insG on the B38 assembly. C__72649949_10 is discontinued but can still be ordered, if needed. Additional Information:
The CYP2D6 gene exhibits copy number variation. Individuals may carry deletion alleles or extra copies of CYP2D6. CYP2D6 SNP genotyping assays run on samples lacking CYP2D6 genes will not amplify, homozygous samples having 1 or more gene copies typically cluster together, and heterozygous samples with more than 2 copies may run between the 2 copy heterozygous and homozygous genotype clusters. In addition, some CYP2D6 alleles contain CYP2D7 pseudogene sequences. For accurate CYP2D6 genotype analysis, copy number analysis must be done. For more information, refer to the PGx Experiments User Guide (Pub. # MAN0009612) Chapter 2 Copy Number Variation section.
Set Membership: |
Validated
Inventoried
|
Panther Classification:
Gene Ontology Categories:
Back To Top