Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Instrument Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Enterprise Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • Our Instagram
      Our Instagram
    • Our Facebook
      Our Facebook
    • Blog Behind the Bench
      Blog Behind the Bench
    • Customer Experience Center (CEC)
      Customer Experience Center (CEC)
    • Ecommerce Exclusives
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__88349720_10
          See other CRTC2 GT Assays ›
          SNP ID:
          rs61804848
          Gene
          CRTC2 DENND4B MIR6737 SLC39A1
          Gene Name
          CREB regulated transcription coactivator 2
          DENN domain containing 4B
          microRNA 6737
          solute carrier family 39 member 1
          Set Membership:
          -
          Chromosome Location:
          Chr.1: 153952604 - 153952604 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          CATCCCATGGCTTCAGCAAATGCTT[G/T]TCATCTAGCAAGTTCTCCTCAATAG

          Assay ID C__88349720_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          1 submissions

          Phenotype:

          MIM: 608972 MIM: 604740

          Literature Links:

          CRTC2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          CRTC2 - CREB regulated transcription coactivator 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_181715.2 828 Missense Mutation GAA,GAC E,D 223 NP_859066.1
          XM_005244946.1 828 Missense Mutation GAA,GAC E,D 228 XP_005245003.1
          XM_005244949.2 828 Missense Mutation GAA,GAC E,D 115 XP_005245006.1
          XM_017000575.1 828 Missense Mutation GAA,GAC E,D 150 XP_016856064.1
          XM_017000576.1 828 Missense Mutation GAA,GAC E,D 145 XP_016856065.1
          XM_017000577.1 828 Missense Mutation GAA,GAC E,D 127 XP_016856066.1
          XM_017000578.1 828 Missense Mutation GAA,GAC E,D 122 XP_016856067.1
          XM_017000579.1 828 Missense Mutation GAA,GAC E,D 17 XP_016856068.1
          DENND4B - DENN domain containing 4B
          There are no transcripts associated with this gene.
          MIR6737 - microRNA 6737
          There are no transcripts associated with this gene.
          SLC39A1 - solute carrier family 39 member 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          transcription cofactor

          Gene Ontology Categories:

          Function(s) Process(es)

          gluconeogenesis
          transcription, DNA-templated
          viral process
          positive regulation of CREB transcription factor activity
          glucose homeostasis
          histone H3-K9 acetylation
          positive regulation of transcription from RNA polymerase II promoter
          protein homotetramerization
          toxin transport
          chromatin binding
          protein binding
          cAMP response element binding protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Find Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Brasil flag icon
          Brasil

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-s26bj:80/100.66.76.101:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0