Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Western Blot Products
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Food and Beverage
    • Lab Solutions
    • Pharma and Biopharma
    • Real-Time PCR
    • Semiconductor Analysis
    • Clinical and Diagnostics
    • Digital Solutions
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • See all services
  • Help and Support
    • Order Help
    • Digital Solutions
    • Product Support
    • Technical Information
    • Training and Education
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__88619058_10
          See other PTGER4 GT Assays ›
          SNP ID:
          rs56277923
          Gene
          PTGER4
          Gene Name
          prostaglandin E receptor 4
          Set Membership:
          -
          Chromosome Location:
          Chr.5: 40684023 - 40684023 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          ATAAGGAATCCTAAAATAGCAGTGG[C/T]ATCAGTTTGTCGCCTTTAGTTTTGG

          Assay ID C__88619058_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 601586

          Literature Links:

          PTGER4 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.08)
          (0.92)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.08)
          (0.92)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.01)
          (0.99)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.22)
          (0.78)
          AMR
          T (0.12)
          (0.88)
          PTGER4 - prostaglandin E receptor 4
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000958.2 Intron NP_000949.1
          XM_017009656.1 Intron XP_016865145.1
          XM_017009657.1 Intron XP_016865146.1
          XM_017009658.1 Intron XP_016865147.1
          XM_017009659.1 Intron XP_016865148.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          G-protein coupled receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of peptide secretion
          immune response
          adenylate cyclase-modulating G-protein coupled receptor signaling pathway
          adenylate cyclase-activating G-protein coupled receptor signaling pathway
          positive regulation of cytosolic calcium ion concentration
          JNK cascade
          female pregnancy
          positive regulation of cell proliferation
          response to mechanical stimulus
          positive regulation of gene expression
          negative regulation of hydrogen peroxide metabolic process
          regulation of circadian sleep/wake cycle, wakefulness
          positive regulation of smooth muscle cell migration
          positive regulation of cAMP biosynthetic process
          response to lipopolysaccharide
          response to progesterone
          positive regulation of interleukin-8 production
          negative regulation of integrin activation
          positive regulation of urine volume
          positive regulation of renal sodium excretion
          T-helper cell differentiation
          negative regulation of circadian sleep/wake cycle, REM sleep
          chemokinesis
          response to drug
          positive regulation of tyrosine phosphorylation of Stat3 protein
          response to amino acid
          positive regulation of osteoblast differentiation
          positive regulation of bone resorption
          positive regulation of cell adhesion
          positive regulation of circadian sleep/wake cycle, non-REM sleep
          negative regulation of cytokine secretion
          negative regulation of interleukin-1 alpha secretion
          positive regulation of cytokine secretion
          negative regulation of inflammatory response
          positive regulation of inflammatory response
          regulation of stress fiber assembly
          negative regulation of nitric-oxide synthase biosynthetic process
          maternal process involved in parturition
          bone development
          positive regulation of mucus secretion
          ERK1 and ERK2 cascade
          cellular response to mechanical stimulus
          cellular response to glucose stimulus
          cellular response to interleukin-1
          cellular response to prostaglandin E stimulus
          positive regulation of wound healing
          ductus arteriosus closure
          positive regulation of hyaluronan biosynthetic process
          response to salt
          negative regulation of ductus arteriosus closure
          negative regulation of small intestine smooth muscle contraction
          positive regulation of calcitonin secretion
          positive regulation of chemokinesis
          positive regulation of matrix metallopeptidase secretion
          negative regulation of tumor necrosis factor secretion
          negative regulation of endothelin secretion
          positive regulation of substance P secretion, neurotransmission
          response to water-immersion restraint stress
          positive regulation of antral ovarian follicle growth
          positive regulation of neutrophil extravasation
          negative regulation of eosinophil extravasation
          positive regulation of interleukin-10 secretion
          prostaglandin E receptor activity
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Taiwan flag icon
          Taiwan

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline