Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__89127731_10
          See other SOX5 GT Assays ›
          SNP ID:
          rs61756181
          Gene
          SOX5
          Gene Name
          SRY-box 5
          Set Membership:
          -
          Chromosome Location:
          Chr.12: 23534420 - 23534420 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TCCCAGGCTCTGGGCTGCTAGACAC[A/G]CTTGAGTGCTCCGAGGGCAGGTGAG

          Assay ID C__89127731_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 604975

          Literature Links:

          SOX5 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.07)
          (0.93)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.11)
          (0.89)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.16)
          (0.84)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.03)
          (0.97)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.01)
          (0.99)
          AMR
          A (0.06)
          (0.94)
          SOX5 - SRY-box 5
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001261414.1 2238 Silent Mutation AGC,AGT S,S 576 NP_001248343.1
          NM_001261415.1 2238 Silent Mutation AGC,AGT S,S 687 NP_001248344.1
          NM_006940.4 2238 Silent Mutation AGC,AGT S,S 697 NP_008871.3
          NM_152989.3 2238 Silent Mutation AGC,AGT S,S 684 NP_694534.1
          NM_178010.2 2238 Silent Mutation AGC,AGT S,S 311 NP_821078.1
          XM_011520831.2 2238 Silent Mutation AGC,AGT S,S 662 XP_011519133.1
          XM_011520832.2 2238 Silent Mutation AGC,AGT S,S 698 XP_011519134.1
          XM_011520833.2 2238 Silent Mutation AGC,AGT S,S 688 XP_011519135.1
          XM_011520834.2 2238 Silent Mutation AGC,AGT S,S 685 XP_011519136.1
          XM_011520835.2 2238 Silent Mutation AGC,AGT S,S 685 XP_011519137.1
          XM_011520837.2 2238 Silent Mutation AGC,AGT S,S 685 XP_011519139.1
          XM_011520838.2 2238 Silent Mutation AGC,AGT S,S 663 XP_011519140.1
          XM_011520842.2 2238 Silent Mutation AGC,AGT S,S 349 XP_011519144.1
          XM_017019888.1 2238 Silent Mutation AGC,AGT S,S 727 XP_016875377.1
          XM_017019889.1 2238 Silent Mutation AGC,AGT S,S 726 XP_016875378.1
          XM_017019890.1 2238 Silent Mutation AGC,AGT S,S 685 XP_016875379.1
          XM_017019891.1 2238 Silent Mutation AGC,AGT S,S 685 XP_016875380.1
          XM_017019892.1 2238 Silent Mutation AGC,AGT S,S 685 XP_016875381.1
          XM_017019893.1 2238 Silent Mutation AGC,AGT S,S 685 XP_016875382.1
          XM_017019894.1 2238 Silent Mutation AGC,AGT S,S 685 XP_016875383.1
          XM_017019895.1 2238 Silent Mutation AGC,AGT S,S 685 XP_016875384.1
          XM_017019896.1 2238 Silent Mutation AGC,AGT S,S 684 XP_016875385.1
          XM_017019897.1 2238 Silent Mutation AGC,AGT S,S 650 XP_016875386.1
          XM_017019898.1 2238 Silent Mutation AGC,AGT S,S 649 XP_016875387.1
          XM_017019899.1 2238 Silent Mutation AGC,AGT S,S 649 XP_016875388.1
          XM_017019900.1 2238 Silent Mutation AGC,AGT S,S 649 XP_016875389.1
          XM_017019901.1 2238 Silent Mutation AGC,AGT S,S 649 XP_016875390.1
          XM_017019902.1 2238 Intron XP_016875391.1
          XM_017019903.1 2238 Intron XP_016875392.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          regulation of transcription, DNA-templated
          transcription from RNA polymerase II promoter
          positive regulation of chondrocyte differentiation
          asymmetric neuroblast division
          positive regulation of cartilage development
          cellular response to transforming growth factor beta stimulus
          positive regulation of mesenchymal stem cell differentiation
          DNA binding
          transcription factor activity, sequence-specific DNA binding
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline