Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__89358299_10
          See other ACE GT Assays ›
          SNP ID:
          rs143320537
          Gene
          ACE
          Gene Name
          angiotensin I converting enzyme
          Set Membership:
          -
          Chromosome Location:
          Chr.17: 63479054 - 63479054 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          TGAGCAGGATCTACTCCACCGCCAA[C/G]GTCTGCCTCCCCAACAAGACTGCCA

          Assay ID C__89358299_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 106180

          Literature Links:

          ACE PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          C (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          C (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          C (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          C (0.00)
          (1.00)
          AMR
          C (0.00)
          (1.00)
          ACE - angiotensin I converting enzyme
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000789.3 499 Missense Mutation AAC,AAG N,K 155 NP_000780.1
          NM_001178057.1 499 Intron NP_001171528.1
          NM_152830.2 499 Intron NP_690043.1
          XM_006721737.3 499 Intron XP_006721800.2

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          metalloprotease

          Gene Ontology Categories:

          Function(s) Process(es)

          kidney development
          blood vessel remodeling
          angiotensin maturation
          angiotensin catabolic process in blood
          regulation of renal output by angiotensin
          neutrophil mediated immunity
          antigen processing and presentation of peptide antigen via MHC class I
          regulation of systemic arterial blood pressure by renin-angiotensin
          spermatogenesis
          regulation of blood pressure
          regulation of smooth muscle cell migration
          regulation of vasoconstriction
          mononuclear cell proliferation
          regulation of vasodilation
          hormone catabolic process
          peptide catabolic process
          beta-amyloid metabolic process
          arachidonic acid secretion
          heart contraction
          regulation of angiotensin metabolic process
          hematopoietic stem cell differentiation
          positive regulation of protein tyrosine kinase activity
          cell proliferation in bone marrow
          positive regulation of peptidyl-tyrosine autophosphorylation
          regulation of hematopoietic stem cell proliferation
          negative regulation of gap junction assembly
          positive regulation of peptidyl-cysteine S-nitrosylation
          endopeptidase activity
          carboxypeptidase activity
          drug binding
          metallopeptidase activity
          exopeptidase activity
          tripeptidyl-peptidase activity
          peptidyl-dipeptidase activity
          zinc ion binding
          chloride ion binding
          mitogen-activated protein kinase kinase binding
          bradykinin receptor binding
          mitogen-activated protein kinase binding
          metallodipeptidase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-hznln:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline