Search Thermo Fisher Scientific
- Contáctenos
- Orden Rápida
-
¿No tiene una cuenta? Crear una cuenta
Search Thermo Fisher Scientific
TCCCCGCCGCCGGCTCCGAAGGCGC[A/C]GCGGGCCAGAACTGCGTCCCCGTGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 124089 MIM: 609358 MIM: 613232 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
COX6B1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
COX6B1 - cytochrome c oxidase subunit 6B1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ETV2 - ETS variant 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001300974.1 | 1309 | Silent Mutation | GCA,GCC | A,A 34 | NP_001287903.1 | |
NM_001304549.1 | 1309 | Intron | NP_001291478.1 | |||
NM_014209.3 | 1309 | Silent Mutation | GCA,GCC | A,A 127 | NP_055024.2 | |
XM_005258652.2 | 1309 | Silent Mutation | GCA,GCC | A,A 155 | XP_005258709.1 | |
XM_011526624.2 | 1309 | Silent Mutation | GCA,GCC | A,A 34 | XP_011524926.1 | |
XM_017026472.1 | 1309 | Silent Mutation | GCA,GCC | A,A 128 | XP_016881961.1 |
RBM42 - RNA binding motif protein 42 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |