Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTCTTTCTTCTCTTTGGACATTCC[C/T]TTCCAGATCTCGCCTGCCTTCTTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600843 MIM: 604328 MIM: 607104 | ||||||||||||||||||||
Literature Links: |
P2RX3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
P2RX3 - purinergic receptor P2X 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SSRP1 - structure specific recognition protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003146.2 | 2242 | Silent Mutation | AAA,AAG | K,K 586 | NP_003137.1 | |
XM_017018180.1 | 2242 | Silent Mutation | AAA,AAG | K,K 720 | XP_016873669.1 | |
XM_017018181.1 | 2242 | Intron | XP_016873670.1 |
TNKS1BP1 - tankyrase 1 binding protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |