Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__97730651_10
          See other PXN GT Assays ›
          SNP ID:
          rs71541561
          Gene
          PXN PXN-AS1
          Gene Name
          paxillin
          PXN antisense RNA 1
          Set Membership:
          -
          Chromosome Location:
          Chr.12: 120213914 - 120213914 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TATAGTTCTCCAGGATGGCCCGGGC[A/G]CAGCCGCCACACTTGGGTGCGAACA

          Assay ID C__97730651_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602505

          Literature Links:

          PXN PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          PXN - paxillin
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001080855.2 2260 Silent Mutation TGC,TGT C,C 479 NP_001074324.1
          NM_001243756.1 2260 Silent Mutation TGC,TGT C,C 493 NP_001230685.1
          NM_002859.3 2260 Silent Mutation TGC,TGT C,C 445 NP_002850.2
          NM_025157.4 2260 Silent Mutation TGC,TGT C,C 312 NP_079433.3
          XM_005253917.3 2260 Silent Mutation TGC,TGT C,C 291 XP_005253974.1
          XM_006719532.1 2260 Silent Mutation TGC,TGT C,C 1017 XP_006719595.1
          XM_006719534.1 2260 Silent Mutation TGC,TGT C,C 884 XP_006719597.1
          XM_006719535.3 2260 Silent Mutation TGC,TGT C,C 884 XP_006719598.1
          XM_006719536.2 2260 Silent Mutation TGC,TGT C,C 884 XP_006719599.1
          XM_011538622.1 2260 Silent Mutation TGC,TGT C,C 884 XP_011536924.1
          XM_011538623.1 2260 Silent Mutation TGC,TGT C,C 884 XP_011536925.1
          XM_017019726.1 2260 Silent Mutation TGC,TGT C,C 1023 XP_016875215.1
          XM_017019727.1 2260 Silent Mutation TGC,TGT C,C 1018 XP_016875216.1
          XM_017019728.1 2260 Silent Mutation TGC,TGT C,C 1015 XP_016875217.1
          XM_017019729.1 2260 Silent Mutation TGC,TGT C,C 975 XP_016875218.1
          XM_017019730.1 2260 Silent Mutation TGC,TGT C,C 1023 XP_016875219.1
          XM_017019731.1 2260 Silent Mutation TGC,TGT C,C 884 XP_016875220.1
          XM_017019732.1 2260 Intron XP_016875221.1
          XM_017019733.1 2260 Silent Mutation TGC,TGT C,C 828 XP_016875222.1
          XM_017019734.1 2260 Silent Mutation TGC,TGT C,C 776 XP_016875223.1
          XM_017019735.1 2260 Silent Mutation TGC,TGT C,C 746 XP_016875224.1
          XM_017019736.1 2260 Silent Mutation TGC,TGT C,C 636 XP_016875225.1
          XM_017019737.1 2260 Silent Mutation TGC,TGT C,C 588 XP_016875226.1
          XM_017019738.1 2260 Silent Mutation TGC,TGT C,C 533 XP_016875227.1
          XM_017019739.1 2260 Silent Mutation TGC,TGT C,C 499 XP_016875228.1
          XM_017019740.1 2260 Silent Mutation TGC,TGT C,C 485 XP_016875229.1
          XM_017019741.1 2260 Silent Mutation TGC,TGT C,C 477 XP_016875230.1
          XM_017019742.1 2260 Silent Mutation TGC,TGT C,C 451 XP_016875231.1
          XM_017019743.1 2260 Silent Mutation TGC,TGT C,C 312 XP_016875232.1
          PXN-AS1 - PXN antisense RNA 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          actin or actin-binding cytoskeletal protein

          Gene Ontology Categories:

          Function(s) Process(es)

          muscle contraction
          cell adhesion
          cell-matrix adhesion
          signal transduction
          signal complex assembly
          epidermal growth factor receptor signaling pathway
          transforming growth factor beta receptor signaling pathway
          cellular response to reactive oxygen species
          vascular endothelial growth factor receptor signaling pathway
          growth hormone receptor signaling pathway
          integrin binding
          protein binding
          beta-catenin binding
          zinc ion binding
          vinculin binding
          protein kinase binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-lnstr:80/100.66.74.145:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline