Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___1011775_20
          See other DRD1 GT Assays ›
          SNP ID:
          rs265981
          Gene
          DRD1
          Gene Name
          dopamine receptor D1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.5: 175443899 - 175443899 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          GCCAGGTCCCAAGAGAGGCGGCGGC[A/G]GCCCACTTCCTTGAAGAGCTGGAGA

          Assay ID C___1011775_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 126449

          Literature Links:

          DRD1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.23)
          (0.77)
          Caucasian - Not Available CEPH (CEU)
          A (0.42)
          (0.58)
          EAS
          A (0.15)
          (0.85)
          African American - Not Available YRI (Yoruba)
          A (0.00)
          (1.00)
          SAS
          A (0.39)
          (0.61)
          Chinese - Not Available JPT (Japanese)
          A (0.13)
          (0.87)
          AFR
          A (0.02)
          (0.98)
          Japanese - Not Available CHB (Han Chinese)
          A (0.17)
          (0.83)
          EUR
          A (0.40)
          (0.60)
          AMR
          A (0.28)
          (0.72)
          DRD1 - dopamine receptor D1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000794.3 262 UTR 5 NP_000785.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          G-protein coupled receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          temperature homeostasis
          conditioned taste aversion
          behavioral fear response
          synaptic transmission, dopaminergic
          response to amphetamine
          negative regulation of protein kinase activity
          protein import into nucleus
          G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger
          adenylate cyclase-activating G-protein coupled receptor signaling pathway
          activation of adenylate cyclase activity
          adenylate cyclase-activating dopamine receptor signaling pathway
          synapse assembly
          learning
          memory
          mating behavior
          grooming behavior
          adult walking behavior
          visual learning
          positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway
          astrocyte development
          response to activity
          dopamine transport
          transmission of nerve impulse
          neuronal action potential
          regulation of vasoconstriction
          calcium-mediated signaling
          dentate gyrus development
          striatum development
          orbitofrontal cortex development
          cerebral cortex GABAergic interneuron migration
          positive regulation of cell migration
          negative regulation of cell migration
          peristalsis
          positive regulation of cAMP biosynthetic process
          response to food
          response to estradiol
          response to retinoic acid
          cellular response to insulin stimulus
          response to nicotine
          operant conditioning
          social behavior
          response to antidepressant
          regulation of dopamine metabolic process
          vasodilation
          negative regulation of circadian sleep/wake cycle, sleep
          dopamine metabolic process
          response to drug
          maternal behavior
          response to amino acid
          positive regulation of potassium ion transport
          response to morphine
          response to ethanol
          positive regulation of membrane potential
          glucose import
          habituation
          sensitization
          behavioral response to cocaine
          regulation of long-term neuronal synaptic plasticity
          response to steroid hormone
          positive regulation of release of sequestered calcium ion into cytosol
          positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway
          regulation of dopamine uptake involved in synaptic transmission
          positive regulation of synaptic transmission, glutamatergic
          prepulse inhibition
          phospholipase C-activating dopamine receptor signaling pathway
          long-term synaptic potentiation
          long term synaptic depression
          cellular response to hypoxia
          cellular response to catecholamine stimulus
          positive regulation of long-term synaptic potentiation
          positive regulation of feeding behavior
          dopamine neurotransmitter receptor activity, coupled via Gs
          G-protein alpha-subunit binding
          dopamine neurotransmitter receptor activity
          protein binding
          drug binding
          protein phosphatase binding
          angiotensin receptor binding
          D3 dopamine receptor binding
          protein complex binding
          dopamine binding
          protein heterodimerization activity
          ATPase binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-9fm2r:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline