Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___1085595_10
          See other HFE GT Assays ›
          SNP ID:
          rs1800562
          Gene
          HFE
          Gene Name
          hemochromatosis
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.6: 26092913 - 26092913 on Build GRCh38
          Polymorphism:
          G/A, Transition substitution
          Context Sequence [VIC/FAM]:

          CCTGGGGAAGAGCAGAGATATACGT[G/A]CCAGGTGGAGCACCCAGGCCTGGAT

          Assay ID C___1085595_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 613609

          Literature Links:

          HFE PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.01)
          (0.99)
          Caucasian - Not Available CEPH (CEU)
          A (0.05)
          (0.95)
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.04)
          (0.96)
          AMR
          A (0.02)
          (0.98)
          HFE - hemochromatosis
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000410.3 465 Missense Mutation TAC,TGC Y,C 282 NP_000401.1
          NM_001300749.1 465 Missense Mutation TAC,TGC Y,C 282 NP_001287678.1
          NM_139003.2 465 Missense Mutation TAC,TGC Y,C 176 NP_620572.1
          NM_139004.2 465 Missense Mutation TAC,TGC Y,C 190 NP_620573.1
          NM_139006.2 465 Missense Mutation TAC,TGC Y,C 268 NP_620575.1
          NM_139007.2 465 Missense Mutation TAC,TGC Y,C 194 NP_620576.1
          NM_139008.2 465 Missense Mutation TAC,TGC Y,C 180 NP_620577.1
          NM_139009.2 465 Missense Mutation TAC,TGC Y,C 259 NP_620578.1
          NM_139010.2 465 Missense Mutation TAC,TGC Y,C 102 NP_620579.1
          NM_139011.2 465 Intron NP_620580.1
          XM_011514543.2 465 Missense Mutation TAC,TGC Y,C 282 XP_011512845.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          major histocompatibility complex protein

          Gene Ontology Categories:

          Function(s) Process(es)

          antigen processing and presentation of peptide antigen via MHC class I
          negative regulation of T cell antigen processing and presentation
          negative regulation of T cell cytokine production
          protein complex assembly
          cellular iron ion homeostasis
          acute-phase response
          immune response
          female pregnancy
          response to iron ion
          cellular response to iron ion starvation
          positive regulation of gene expression
          positive regulation of pathway-restricted SMAD protein phosphorylation
          antigen processing and presentation
          BMP signaling pathway
          positive regulation of protein binding
          negative regulation of proteasomal ubiquitin-dependent protein catabolic process
          hormone biosynthetic process
          positive regulation of receptor-mediated endocytosis
          iron ion homeostasis
          multicellular organismal iron ion homeostasis
          cellular response to iron ion
          positive regulation of peptide hormone secretion
          liver regeneration
          iron ion import into cell
          negative regulation of receptor binding
          positive regulation of receptor binding
          positive regulation of ferrous iron import into cell
          negative regulation of antigen processing and presentation of endogenous peptide antigen via MHC class I
          positive regulation of ferrous iron binding
          positive regulation of transferrin receptor binding
          response to iron ion starvation
          regulation of protein localization to cell surface
          negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process
          negative regulation of receptor activity
          positive regulation of receptor activity
          negative regulation of CD8-positive, alpha-beta T cell activation
          antigen binding
          receptor binding
          protein binding
          beta-2-microglobulin binding
          co-receptor binding
          peptide antigen binding
          transferrin receptor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-zsnhf:80/100.66.75.14:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline