Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___1202883_20
          See other C1ORF167 GT Assays ›
          SNP ID:
          rs1801133
          Gene
          C1orf167 CLCN6 MTHFR
          Gene Name
          chromosome 1 open reading frame 167
          chloride voltage-gated channel 6
          methylenetetrahydrofolate reductase (NAD(P)H)
          Set Membership:
          > HapMap > JSNP
          Chromosome Location:
          Chr.1: 11796321 - 11796321 on Build GRCh38
          Polymorphism:
          G/A, Transition substitution
          Context Sequence [VIC/FAM]:

          GAAAAGCTGCGTGATGATGAAATCG[G/A]CTCCCGCAGACACCTTCTCCTTCAA

          Assay ID C___1202883_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          102 submissions

          Phenotype:

          MIM: 602726 MIM: 607093

          Literature Links:

          C1orf167 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.25)
          (0.75)
          Caucasian - Not Available CEPH (CEU)
          T (0.31)
          (0.69)
          EAS
          T (0.30)
          (0.70)
          African American - Not Available YRI (Yoruba)
          T (0.09)
          (0.91)
          SAS
          T (0.12)
          (0.88)
          Chinese - Not Available JPT (Japanese)
          T (0.36)
          (0.64)
          AFR
          T (0.09)
          (0.91)
          Japanese - Not Available CHB (Han Chinese)
          C (0.49)
          (0.51)
          EUR
          T (0.37)
          (0.63)
          AMR
          T (0.47)
          (0.53)
          C1orf167 - chromosome 1 open reading frame 167
          There are no transcripts associated with this gene.
          CLCN6 - chloride voltage-gated channel 6
          There are no transcripts associated with this gene.
          MTHFR - methylenetetrahydrofolate reductase (NAD(P)H)
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_005957.4 1731 Missense Mutation GCC,GTC A,V 222 NP_005948.3
          XM_005263458.3 1731 Missense Mutation GCC,GTC A,V 263 XP_005263515.1
          XM_005263460.4 1731 Missense Mutation GCC,GTC A,V 222 XP_005263517.1
          XM_005263462.4 1731 Missense Mutation GCC,GTC A,V 222 XP_005263519.1
          XM_005263463.3 1731 Missense Mutation GCC,GTC A,V 140 XP_005263520.1
          XM_011541495.2 1731 Missense Mutation GCC,GTC A,V 262 XP_011539797.1
          XM_011541496.2 1731 Missense Mutation GCC,GTC A,V 263 XP_011539798.1
          XM_017001328.1 1731 Missense Mutation GCC,GTC A,V 263 XP_016856817.1

          Back To Top

          More Information


          Set Membership:

          HapMap JSNP

          Panther Classification:

          Molecular Function -

          reductase

          Gene Ontology Categories:

          Function(s) Process(es)

          response to hypoxia
          cellular amino acid metabolic process
          methionine metabolic process
          blood circulation
          regulation of histone methylation
          response to vitamin B2
          tetrahydrofolate interconversion
          response to drug
          response to amino acid
          S-adenosylmethionine metabolic process
          folic acid metabolic process
          homocysteine metabolic process
          response to folic acid
          oxidation-reduction process
          response to interleukin-1
          heterochromatin maintenance
          methylenetetrahydrofolate reductase (NAD(P)H) activity
          protein complex binding
          flavin adenine dinucleotide binding
          NADP binding
          modified amino acid binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline