Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___1311089_10
          See other GRM7 GT Assays ›
          SNP ID:
          rs779748
          Gene
          GRM7 GRM7-AS1
          Gene Name
          glutamate metabotropic receptor 7
          GRM7 antisense RNA 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.3: 7534955 - 7534955 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CCAGTGTCATGAGAATGTACATGCG[A/G]GCTATTGCCCTCTTTCCACTTTTCC

          Assay ID C___1311089_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 604101

          Literature Links:

          GRM7 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.36)
          (0.64)
          Caucasian - Not Available CEPH (CEU)
          T (0.46)
          (0.54)
          EAS
          T (0.49)
          (0.51)
          African American - Not Available YRI (Yoruba)
          T (0.12)
          (0.88)
          SAS
          T (0.35)
          (0.65)
          Chinese - Not Available JPT (Japanese)
          C (0.49)
          (0.51)
          AFR
          T (0.15)
          (0.85)
          Japanese - Not Available CHB (Han Chinese)
          C (0.50)
          (0.50)
          EUR
          T (0.48)
          (0.52)
          AMR
          T (0.40)
          (0.60)
          GRM7 - glutamate metabotropic receptor 7
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000844.3 Intron NP_000835.1
          NM_181874.2 Intron NP_870989.1
          XM_017006272.1 Intron XP_016861761.1
          XM_017006273.1 Intron XP_016861762.1
          GRM7-AS1 - GRM7 antisense RNA 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          G-protein coupled receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          conditioned taste aversion
          behavioral fear response
          adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway
          chemical synaptic transmission
          sensory perception of sound
          sensory perception of smell
          short-term memory
          negative regulation of glutamate secretion
          transmission of nerve impulse
          adult behavior
          negative regulation of cAMP biosynthetic process
          regulation of cyclase activity
          regulation of synaptic transmission, glutamatergic
          calcium ion transmembrane transport
          group III metabotropic glutamate receptor activity
          voltage-gated calcium channel activity
          calcium channel regulator activity
          glutamate receptor activity
          adenylate cyclase inhibitor activity
          serine binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline