Search
LOADING 
- SNP ID:
- rs34879108
- Gene
-
C1RC1RL - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.12: 7093807 - 7093807 on Build GRCh38
- Polymorphism:
- C/T, Transition Substitution
- Context Sequence [VIC/FAM]:
GGGTTTCTCCAGCAGGCCTGTGTGT[C/T]AGAGCTGAGGACTGAACCTAACGGA
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613785
MIM: 608974
|
||||||||||||||||||||
Literature Links: |
C1R PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| C1R - complement C1r subcomponent | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| C1RL - complement C1r subcomponent like | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001297640.1 | 900 | Intron | NP_001284569.1 | |||
| NM_001297642.1 | 900 | Intron | NP_001284571.1 | |||
| NM_001297643.1 | 900 | Intron | NP_001284572.1 | |||
| NM_016546.3 | 900 | Intron | NP_057630.2 | |||
| XM_017019397.1 | 900 | Intron | XP_016874886.1 | |||
| XM_017019398.1 | 900 | Intron | XP_016874887.1 | |||
| XM_017019399.1 | 900 | Intron | XP_016874888.1 | |||
| XM_017019400.1 | 900 | Missense Mutation | AAC,GAC | N,D 285 | XP_016874889.1 | |
| XM_017019401.1 | 900 | Intron | XP_016874890.1 | |||
| XM_017019402.1 | 900 | Silent Mutation | TAA,TGA | *,* 269 | XP_016874891.1 | |
| XM_017019403.1 | 900 | Intron | XP_016874892.1 | |||
| XM_017019404.1 | 900 | Intron | XP_016874893.1 | |||
Back To Top