Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Productos
    • Anticuerpos
    • Oligonucleótidos, cebadores, sondas y genes
    • Ensayos de PCR en tiempo real TaqMan
    • Medios de cultivos celulares
    • Productos químicos
    • Columnas y cartuchos de cromatografía
    • Equipo de laboratorio
    • Material de plástico y suministros para laboratorio
    • Microplacas
    • Productos más ecológicos
    • Ver todas las categorías de productos
  • Applications
    • Bioprocesamiento
    • Cultivo celular y transfección
    • Terapia celular y génica
    • Cromatografía
    • Pruebas moleculares
    • Soluciones digitales
    • Extracción y análisis de ADN y ARN
    • Espectroscopía, análisis elemental y de isótopos
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Servicios personalizados
    • Servicios de leasing y financiación
    • Servicios de instrumentos
    • Informática de laboratorio
    • OEM y oferta comercial
    • Servicios de formación
    • Unity Lab Services
    • Ver todos los servicios
  • Ayuda y soporte técnico
    • Regístrese para obtener una cuenta
    • Cómo hacer un pedido
    • Asistencia para el instrumental
    • Centros de soporte técnico
    • Centros de formación
    • Vea todos los temas de ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Promociones
  • Contacto
  • Pedido rápido
  • Estado del pedido y seguimiento
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Estado del pedido
          • Pedido rápido
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Cuenta
            • Pedidos
            • Connect: laboratorio, datos, aplicaciones
            • Productos y proyectos personalizados
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___1440244_10
          See other LOC105375077 GT Assays ›
          SNP ID:
          rs1200425
          Gene
          LOC105375077 RUNX2
          Gene Name
          uncharacterized LOC105375077
          runt related transcription factor 2
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.6: 45559395 - 45559395 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TACCTATAGATTTGGAATGGCTTTT[A/G]GAATGGAGAAATTATGGGGAGTTTT

          Assay ID C___1440244_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 600211

          Literature Links:

          LOC105375077 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.43)
          (0.57)
          Caucasian - Not Available CEPH (CEU)
          T (0.42)
          (0.58)
          EAS
          T (0.31)
          (0.69)
          African American - Not Available YRI (Yoruba)
          C (0.34)
          (0.66)
          SAS
          T (0.30)
          (0.70)
          Chinese - Not Available JPT (Japanese)
          T (0.37)
          (0.63)
          AFR
          C (0.37)
          (0.63)
          Japanese - Not Available CHB (Han Chinese)
          T (0.30)
          (0.70)
          EUR
          T (0.38)
          (0.62)
          AMR
          T (0.49)
          (0.51)
          LOC105375077 - uncharacterized LOC105375077
          There are no transcripts associated with this gene.
          RUNX2 - runt related transcription factor 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001015051.3 Intron NP_001015051.3
          NM_001024630.3 Intron NP_001019801.3
          NM_001278478.1 Intron NP_001265407.1
          XM_006715232.1 Intron XP_006715295.1
          XM_011514960.2 Intron XP_011513262.1
          XM_011514961.2 Intron XP_011513263.1
          XM_011514962.2 Intron XP_011513264.1
          XM_011514963.2 Intron XP_011513265.1
          XM_011514964.2 Intron XP_011513266.1
          XM_011514965.2 Intron XP_011513267.1
          XM_011514966.2 Intron XP_011513268.1
          XM_017011391.1 Intron XP_016866880.1
          XM_017011392.1 Intron XP_016866881.1
          XM_017011393.1 Intron XP_016866882.1
          XM_017011394.1 Intron XP_016866883.1
          XM_017011395.1 Intron XP_016866884.1
          XM_017011396.1 Intron XP_016866885.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          Runt transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          ossification
          osteoblast differentiation
          endochondral ossification
          osteoblast fate commitment
          chondrocyte differentiation
          chondrocyte development
          osteoblast development
          regulation of transcription from RNA polymerase II promoter
          transcription from RNA polymerase II promoter
          positive regulation of cell proliferation
          hemopoiesis
          neuron differentiation
          T cell differentiation
          BMP signaling pathway
          positive regulation of chondrocyte differentiation
          embryonic forelimb morphogenesis
          regulation of fibroblast growth factor receptor signaling pathway
          odontogenesis of dentin-containing tooth
          regulation of odontogenesis of dentin-containing tooth
          cellular response to fibroblast growth factor stimulus
          regulation of cell differentiation
          positive regulation of osteoblast differentiation
          negative regulation of smoothened signaling pathway
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          cell maturation
          embryonic cranial skeleton morphogenesis
          stem cell differentiation
          cellular response to BMP stimulus
          positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          RNA polymerase II core promoter sequence-specific DNA binding
          RNA polymerase II transcription factor activity, sequence-specific DNA binding
          transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding
          chromatin binding
          transcription factor activity, sequence-specific DNA binding
          protein binding
          ATP binding
          protein domain specific binding
          histone deacetylase binding
          bHLH transcription factor binding
          repressing transcription factor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estado del pedido
          • Ayuda con el pedido
          • Pedido rápido
          • Centro de suministros
          • eProcurement (B2B)
          Asistencia Plus Icon Minus Icon
          • Ayuda y soporte técnico
          • Contacto
          • Centros de soporte técnico
          • Documentos y certificados
          • Informar de un problema del sitio web
          Recursos Plus Icon Minus Icon
          • Centros de formación
          • Promociones
          • Eventos y seminarios web
          • Redes sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Carreras profesionales Carreras profesionales
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas registradas
          • Políticas y avisos
          Nuestra cartera Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Spain flag icon
          Spain

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-hznln:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline