Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___1756707_10
          See other PHACTR1 GT Assays ›
          SNP ID:
          rs9349379
          Gene
          PHACTR1
          Gene Name
          phosphatase and actin regulator 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.6: 12903725 - 12903725 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TCTATGCCCTTGAGATCATATAAAA[A/G]TAGCTTAAAATCATTGGCCATAGTT

          Assay ID C___1756707_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 608723

          Literature Links:

          PHACTR1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.38)
          (0.62)
          Caucasian - Not Available CEPH (CEU)
          G (0.37)
          (0.63)
          EAS
          A (0.32)
          (0.68)
          African American - Not Available YRI (Yoruba)
          G (0.03)
          (0.97)
          SAS
          A (0.49)
          (0.51)
          Chinese - Not Available JPT (Japanese)
          A (0.27)
          (0.73)
          AFR
          G (0.03)
          (0.97)
          Japanese - Not Available CHB (Han Chinese)
          A (0.21)
          (0.79)
          EUR
          G (0.40)
          (0.60)
          AMR
          G (0.38)
          (0.62)
          PHACTR1 - phosphatase and actin regulator 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001242648.2 Intron NP_001229577.1
          NM_001322308.1 Intron NP_001309237.1
          NM_001322309.1 Intron NP_001309238.1
          NM_001322310.1 Intron NP_001309239.1
          NM_001322311.1 Intron NP_001309240.1
          NM_001322312.1 Intron NP_001309241.1
          NM_001322313.1 Intron NP_001309242.1
          NM_001322314.1 Intron NP_001309243.1
          NM_030948.3 Intron NP_112210.1
          XM_005248934.2 Intron XP_005248991.1
          XM_017010452.1 Intron XP_016865941.1
          XM_017010454.1 Intron XP_016865943.1
          XM_017010455.1 Intron XP_016865944.1
          XM_017010456.1 Intron XP_016865945.1
          XM_017010457.1 Intron XP_016865946.1
          XM_017010458.1 Intron XP_016865947.1
          XM_017010459.1 Intron XP_016865948.1
          XM_017010460.1 Intron XP_016865949.1
          XM_017010461.1 Intron XP_016865950.1
          XM_017010462.1 Intron XP_016865951.1
          XM_017010463.1 Intron XP_016865952.1
          XM_017010464.1 Intron XP_016865953.1
          XM_017010465.1 Intron XP_016865954.1
          XM_017010466.1 Intron XP_016865955.1
          XM_017010467.1 Intron XP_016865956.1
          XM_017010469.1 Intron XP_016865958.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          phosphatase modulator

          Gene Ontology Categories:

          Function(s) Process(es)

          actomyosin structure organization
          actin cytoskeleton reorganization
          negative regulation of catalytic activity
          stress fiber assembly
          cell motility
          actin binding
          protein phosphatase inhibitor activity
          protein phosphatase 1 binding
          protein phosphatase type 1 regulator activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-fcf5f9d6d-ff6sw:80/100.66.79.169:80.
          git-commit: 856de8fa7eff2d55603d92afdf035972e45c3e8a
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.51.0-2026.05.21-1.0