Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___1756707_10
          See other PHACTR1 GT Assays ›
          SNP ID:
          rs9349379
          Gene
          PHACTR1
          Gene Name
          phosphatase and actin regulator 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.6: 12903725 - 12903725 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TCTATGCCCTTGAGATCATATAAAA[A/G]TAGCTTAAAATCATTGGCCATAGTT

          Assay ID C___1756707_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 608723

          Literature Links:

          PHACTR1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.38)
          (0.62)
          Caucasian - Not Available CEPH (CEU)
          G (0.37)
          (0.63)
          EAS
          A (0.32)
          (0.68)
          African American - Not Available YRI (Yoruba)
          G (0.03)
          (0.97)
          SAS
          A (0.49)
          (0.51)
          Chinese - Not Available JPT (Japanese)
          A (0.27)
          (0.73)
          AFR
          G (0.03)
          (0.97)
          Japanese - Not Available CHB (Han Chinese)
          A (0.21)
          (0.79)
          EUR
          G (0.40)
          (0.60)
          AMR
          G (0.38)
          (0.62)
          PHACTR1 - phosphatase and actin regulator 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001242648.2 Intron NP_001229577.1
          NM_001322308.1 Intron NP_001309237.1
          NM_001322309.1 Intron NP_001309238.1
          NM_001322310.1 Intron NP_001309239.1
          NM_001322311.1 Intron NP_001309240.1
          NM_001322312.1 Intron NP_001309241.1
          NM_001322313.1 Intron NP_001309242.1
          NM_001322314.1 Intron NP_001309243.1
          NM_030948.3 Intron NP_112210.1
          XM_005248934.2 Intron XP_005248991.1
          XM_017010452.1 Intron XP_016865941.1
          XM_017010454.1 Intron XP_016865943.1
          XM_017010455.1 Intron XP_016865944.1
          XM_017010456.1 Intron XP_016865945.1
          XM_017010457.1 Intron XP_016865946.1
          XM_017010458.1 Intron XP_016865947.1
          XM_017010459.1 Intron XP_016865948.1
          XM_017010460.1 Intron XP_016865949.1
          XM_017010461.1 Intron XP_016865950.1
          XM_017010462.1 Intron XP_016865951.1
          XM_017010463.1 Intron XP_016865952.1
          XM_017010464.1 Intron XP_016865953.1
          XM_017010465.1 Intron XP_016865954.1
          XM_017010466.1 Intron XP_016865955.1
          XM_017010467.1 Intron XP_016865956.1
          XM_017010469.1 Intron XP_016865958.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          phosphatase modulator

          Gene Ontology Categories:

          Function(s) Process(es)

          actomyosin structure organization
          actin cytoskeleton reorganization
          negative regulation of catalytic activity
          stress fiber assembly
          cell motility
          actin binding
          protein phosphatase inhibitor activity
          protein phosphatase 1 binding
          protein phosphatase type 1 regulator activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7d94cb4b65-6wvps:80/100.66.75.98:80.
          git-commit: c9e08c96761173abe34e68f880379696776a4827
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.44.1-2026.02.97.1.0