Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___1844009_10
          See other TERT GT Assays ›
          SNP ID:
          rs2736100
          Gene
          TERT
          Gene Name
          telomerase reverse transcriptase
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.5: 1286401 - 1286401 on Build GRCh38
          Polymorphism:
          A/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          GAAAAGCAGGGCGGGGGCAAAGCTA[A/C]AGAAACACTCAACACGGAAAACAAT

          Assay ID C___1844009_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 187270

          Literature Links:

          TERT PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.48)
          (0.52)
          Caucasian - Not Available CEPH (CEU)
          T (0.47)
          (0.53)
          EAS
          G (0.42)
          (0.58)
          African American - Not Available YRI (Yoruba)
          G (0.39)
          (0.61)
          SAS
          T (0.40)
          (0.60)
          Chinese - Not Available JPT (Japanese)
          G (0.38)
          (0.62)
          AFR
          G (0.47)
          (0.53)
          Japanese - Not Available CHB (Han Chinese)
          G (0.41)
          (0.59)
          EUR
          G (0.50)
          (0.50)
          AMR
          G (0.43)
          (0.57)
          TERT - telomerase reverse transcriptase
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001193376.1 Intron NP_001180305.1
          NM_198253.2 Intron NP_937983.2
          XM_017009796.1 Intron XP_016865285.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          DNA metabolism protein

          Gene Ontology Categories:

          Function(s) Process(es)

          telomere maintenance
          transcription, RNA-templated
          RNA-dependent DNA biosynthetic process
          telomere maintenance via telomerase
          mitochondrion organization
          negative regulation of gene expression
          DNA strand elongation
          positive regulation of Wnt signaling pathway
          production of siRNA involved in RNA interference
          regulation of protein stability
          positive regulation of protein binding
          RNA biosynthetic process
          positive regulation of hair cycle
          positive regulation of nitric-oxide synthase activity
          establishment of protein localization to telomere
          cellular response to hypoxia
          DNA biosynthetic process
          replicative senescence
          positive regulation of pri-miRNA transcription from RNA polymerase II promoter
          negative regulation of production of siRNA involved in RNA interference
          positive regulation of protein localization to nucleolus
          beta-catenin-TCF complex assembly
          positive regulation of stem cell proliferation
          negative regulation of cellular senescence
          negative regulation of extrinsic apoptotic signaling pathway in absence of ligand
          tRNA binding
          transcription coactivator binding
          DNA binding
          telomerase activity
          telomerase RNA reverse transcriptase activity
          RNA binding
          RNA-directed DNA polymerase activity
          RNA-directed RNA polymerase activity
          protein binding
          nucleotidyltransferase activity
          telomeric DNA binding
          protein homodimerization activity
          metal ion binding
          telomerase RNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-fcf5f9d6d-dcxfx:80/100.66.77.77:80.
          git-commit: 856de8fa7eff2d55603d92afdf035972e45c3e8a
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.51.0-2026.05.21-1.0