Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___2064624_20
          See other BLOC1S5-TXNDC5 GT Assays ›
          SNP ID:
          rs1043784
          Gene
          BLOC1S5-TXNDC5 BMP6 TXNDC5
          Gene Name
          BLOC1S5-TXNDC5 readthrough (NMD candidate)
          bone morphogenetic protein 6
          thioredoxin domain containing 5
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.6: 7881698 - 7881698 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TAAAAAAAGAATTATCTGTGAACCA[C/T]ACGTGATTAATAAAGATTTCCTTTA

          Assay ID C___2064624_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 112266 MIM: 616412

          Literature Links:

          BLOC1S5-TXNDC5 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.22)
          (0.78)
          Caucasian - Not Available CEPH (CEU)
          G (0.15)
          (0.85)
          EAS
          G (0.10)
          (0.90)
          African American - Not Available YRI (Yoruba)
          A (0.44)
          (0.56)
          SAS
          G (0.12)
          (0.88)
          Chinese - Not Available JPT (Japanese)
          G (0.06)
          (0.94)
          AFR
          A (0.48)
          (0.52)
          Japanese - Not Available CHB (Han Chinese)
          G (0.09)
          (0.91)
          EUR
          G (0.13)
          (0.87)
          AMR
          G (0.13)
          (0.87)
          BLOC1S5-TXNDC5 - BLOC1S5-TXNDC5 readthrough (NMD candidate)
          There are no transcripts associated with this gene.
          BMP6 - bone morphogenetic protein 6
          There are no transcripts associated with this gene.
          TXNDC5 - thioredoxin domain containing 5
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001145549.2 2783 UTR 3 NP_001139021.1
          NM_030810.3 2783 UTR 3 NP_110437.2

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          chaperone

          Gene Ontology Categories:

          Function(s) Process(es)

          protein folding
          response to endoplasmic reticulum stress
          negative regulation of apoptotic process
          apoptotic cell clearance
          cell redox homeostasis
          protein disulfide isomerase activity
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-b2k9d:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline