Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___2084764_20
          See other ADRB2 GT Assays ›
          SNP ID:
          rs1042713
          Gene
          ADRB2
          Gene Name
          adrenoceptor beta 2
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.5: 148826877 - 148826877 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CAGCGCCTTCTTGCTGGCACCCAAT[A/G]GAAGCCATGCGCCGGACCACGACGT

          Assay ID C___2084764_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 109690

          Literature Links:

          ADRB2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.48)
          (0.52)
          Caucasian - Not Available CEPH (CEU)
          A (0.36)
          (0.64)
          EAS
          G (0.45)
          (0.55)
          African American - Not Available YRI (Yoruba)
          G (0.50)
          (0.50)
          SAS
          A (0.45)
          (0.55)
          Chinese - Not Available JPT (Japanese)
          A (0.44)
          (0.56)
          AFR
          G (0.48)
          (0.52)
          Japanese - Not Available CHB (Han Chinese)
          G (0.45)
          (0.55)
          EUR
          A (0.39)
          (0.61)
          AMR
          A (0.46)
          (0.54)
          ADRB2 - adrenoceptor beta 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000024.5 285 Missense Mutation AGA,GGA R,G 16 NP_000015.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          G-protein coupled receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          diet induced thermogenesis
          vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure
          desensitization of G-protein coupled receptor protein signaling pathway by arrestin
          diaphragm contraction
          positive regulation of the force of heart contraction by epinephrine
          receptor-mediated endocytosis
          cell surface receptor signaling pathway
          activation of transmembrane receptor protein tyrosine kinase activity
          adenylate cyclase-modulating G-protein coupled receptor signaling pathway
          activation of adenylate cyclase activity
          cell-cell signaling
          female pregnancy
          aging
          positive regulation of cell proliferation
          associative learning
          endosome to lysosome transport
          response to cold
          positive regulation of sodium ion transport
          negative regulation of angiogenesis
          negative regulation of ossification
          positive regulation of bone mineralization
          positive regulation of protein ubiquitination
          heat generation
          response to progesterone
          positive regulation of ATPase activity
          response to testosterone
          synaptic transmission, glutamatergic
          negative regulation of urine volume
          negative regulation of multicellular organism growth
          wound healing
          positive regulation of apoptotic process
          positive regulation of potassium ion transport
          positive regulation of MAPK cascade
          response to estrogen
          estrous cycle
          bone resorption
          positive regulation of vasodilation
          positive regulation of transcription from RNA polymerase II promoter
          negative regulation of smooth muscle contraction
          positive regulation of skeletal muscle tissue growth
          negative regulation of inflammatory response
          brown fat cell differentiation
          regulation of calcium ion transport
          regulation of sensory perception of pain
          excitatory postsynaptic potential
          cellular response to hypoxia
          response to dexamethasone
          response to monoamine
          adenylate cyclase-activating adrenergic receptor signaling pathway
          negative regulation of platelet aggregation
          liver regeneration
          positive regulation of autophagosome maturation
          positive regulation of lipophagy
          positive regulation of mitophagy in response to mitochondrial depolarization
          G-protein alpha-subunit binding
          beta2-adrenergic receptor activity
          protein binding
          drug binding
          adenylate cyclase binding
          potassium channel regulator activity
          B2 bradykinin receptor binding
          protein complex binding
          dopamine binding
          ionotropic glutamate receptor binding
          protein homodimerization activity
          epinephrine binding
          norepinephrine binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-vzwvz:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline