Search
Search

G6PD
IKBKGGTCATCATCTTGGTGTACACGGCCT[T/C]GTTGGGCTGCACGCGGATCACCAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
G6PD PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| G6PD - glucose-6-phosphate dehydrogenase | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_000402.4 | 1319 | Missense Mutation | AAG,GAG | K,E 428 | NP_000393.4 | |
| NM_001042351.2 | 1319 | Missense Mutation | AAG,GAG | K,E 398 | NP_001035810.1 | |
| IKBKG - inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||