Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Nuevos productos
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___2287943_10
          See other BRCA1 GT Assays ›
          SNP ID:
          rs799917
          Gene
          BRCA1
          Gene Name
          BRCA1, DNA repair associated
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.17: 43092919 - 43092919 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TTCTGCATTTCCTGGATTTGAAAAC[A/G]GAGCAAATGACTGGCGCTTTGAAAC

          Assay ID C___2287943_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 113705

          Literature Links:

          BRCA1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.46)
          (0.54)
          Caucasian - Not Available CEPH (CEU)
          A (0.34)
          (0.66)
          EAS
          A (0.37)
          (0.63)
          African American - Not Available YRI (Yoruba)
          C (0.07)
          (0.93)
          SAS
          G (0.47)
          (0.53)
          Chinese - Not Available JPT (Japanese)
          T (0.27)
          (0.73)
          AFR
          C (0.12)
          (0.88)
          Japanese - Not Available CHB (Han Chinese)
          A (0.31)
          (0.69)
          EUR
          A (0.36)
          (0.64)
          AMR
          A (0.43)
          (0.57)
          BRCA1 - BRCA1, DNA repair associated
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_007294.3 2844 Missense Mutation CAG,CGG Q,R 871 NP_009225.1
          NM_007297.3 2844 Missense Mutation CAG,CGG Q,R 824 NP_009228.2
          NM_007298.3 2844 Intron NP_009229.2
          NM_007299.3 2844 Intron NP_009230.2
          NM_007300.3 2844 Missense Mutation CAG,CGG Q,R 871 NP_009231.2

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          ubiquitin-protein ligase protein modifying enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          double-strand break repair via homologous recombination
          DNA double-strand break processing
          DNA synthesis involved in DNA repair
          strand displacement
          DNA replication
          postreplication repair
          double-strand break repair
          double-strand break repair via nonhomologous end joining
          regulation of gene expression by genetic imprinting
          transcription, DNA-templated
          regulation of transcription from RNA polymerase II promoter
          regulation of transcription from RNA polymerase III promoter
          fatty acid biosynthetic process
          apoptotic process
          cellular response to DNA damage stimulus
          DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator
          chromosome segregation
          centrosome cycle
          brain development
          response to nutrient
          intrinsic apoptotic signaling pathway in response to DNA damage
          dosage compensation by inactivation of X chromosome
          response to ionizing radiation
          positive regulation of vascular endothelial growth factor production
          positive regulation of gene expression
          protein ubiquitination
          protein sumoylation
          androgen receptor signaling pathway
          chromosome breakage
          positive regulation of protein ubiquitination
          G2 DNA damage checkpoint
          response to estradiol
          negative regulation of intracellular estrogen receptor signaling pathway
          positive regulation of protein import into nucleus, translocation
          positive regulation of histone acetylation
          negative regulation of histone acetylation
          regulation of cell proliferation
          regulation of apoptotic process
          chordate embryonic development
          response to estrogen
          regulation of DNA methylation
          negative regulation of fatty acid biosynthetic process
          positive regulation of DNA repair
          positive regulation of angiogenesis
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          negative regulation of centriole replication
          positive regulation of histone H3-K4 methylation
          negative regulation of histone H3-K4 methylation
          negative regulation of histone H3-K9 methylation
          positive regulation of histone H3-K9 methylation
          protein autoubiquitination
          positive regulation of histone H4-K20 methylation
          positive regulation of cell cycle arrest
          cellular response to tumor necrosis factor
          cellular response to indole-3-methanol
          protein K6-linked ubiquitination
          regulation of signal transduction by p53 class mediator
          negative regulation of extrinsic apoptotic signaling pathway via death domain receptors
          negative regulation of reactive oxygen species metabolic process
          positive regulation of histone H3-K9 acetylation
          positive regulation of histone H4-K16 acetylation
          DNA binding
          chromatin binding
          damaged DNA binding
          transcription coactivator activity
          RNA binding
          ubiquitin-protein transferase activity
          protein binding
          zinc ion binding
          tubulin binding
          ligase activity
          enzyme binding
          ubiquitin protein ligase binding
          transcription regulatory region DNA binding
          androgen receptor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-79565875f6-n44ml:80/100.66.76.16:80.
          git-commit: 280dcbe45276d5d6e613c14d399020b8a49b7116
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.57.0-Offline