Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___2512465_20
          See other TSPO GT Assays ›
          SNP ID:
          rs6971
          Gene
          TSPO TTLL12
          Gene Name
          translocator protein
          tubulin tyrosine ligase like 12
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.22: 43162920 - 43162920 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CCCCTACCTGGCCTGGCTGGCCTTC[A/G]CGACCACACTCAACTACTGCGTATG

          Assay ID C___2512465_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 109610

          Literature Links:

          TSPO PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.17)
          (0.83)
          Caucasian - Not Available CEPH (CEU)
          T (0.29)
          (0.71)
          EAS
          T (0.05)
          (0.95)
          African American - Not Available YRI (Yoruba)
          T (0.11)
          (0.89)
          SAS
          T (0.14)
          (0.86)
          Chinese - Not Available JPT (Japanese)
          T (0.04)
          (0.96)
          AFR
          T (0.17)
          (0.83)
          Japanese - Not Available CHB (Han Chinese)
          T (0.01)
          (0.99)
          EUR
          T (0.34)
          (0.66)
          AMR
          T (0.15)
          (0.85)
          TSPO - translocator protein
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000714.5 559 Missense Mutation ACG,GCG T,A 147 NP_000705.2
          NM_001256530.1 559 Missense Mutation ACG,GCG T,A 147 NP_001243459.1
          NM_001256531.1 559 Missense Mutation ACG,GCG T,A 147 NP_001243460.1
          TTLL12 - tubulin tyrosine ligase like 12
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          protein targeting to mitochondrion
          steroid biosynthetic process
          heme biosynthetic process
          anion transport
          chloride transport
          lipid transport
          apoptotic process
          signal transduction
          chemical synaptic transmission
          aging
          steroid metabolic process
          cell proliferation
          glial cell migration
          response to manganese ion
          response to vitamin B1
          positive regulation of necrotic cell death
          peripheral nervous system axon regeneration
          adrenal gland development
          negative regulation of protein ubiquitination
          regulation of cholesterol transport
          response to progesterone
          negative regulation of tumor necrosis factor production
          response to testosterone
          response to drug
          positive regulation of apoptotic process
          negative regulation of nitric oxide biosynthetic process
          behavioral response to pain
          regulation of steroid biosynthetic process
          positive regulation of mitochondrial depolarization
          positive regulation of calcium ion transport
          contact inhibition
          positive regulation of glial cell proliferation
          negative regulation of glial cell proliferation
          cellular response to lipopolysaccharide
          cellular response to zinc ion
          cellular hypotonic response
          maintenance of protein location in mitochondrion
          negative regulation of mitophagy
          negative regulation of ATP metabolic process
          positive regulation of reactive oxygen species metabolic process
          androgen binding
          protein binding
          benzodiazepine receptor activity
          cholesterol binding
          ion channel binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-vzwvz:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline