Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___2532959_20
          See other CD3EAP GT Assays ›
          SNP ID:
          rs11615
          Gene
          CD3EAP ERCC1
          Gene Name
          CD3e molecule associated protein
          ERCC excision repair 1, endonuclease non-catalytic subunit
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.19: 45420395 - 45420395 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TTACGTCGCCAAATTCCCAGGGCAC[A/G]TTGCGCACGAACTTCAGTACGGGAT

          Assay ID C___2532959_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 107325 MIM: 126380

          Literature Links:

          CD3EAP PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.33)
          (0.67)
          Caucasian - Not Available CEPH (CEU)
          C (0.36)
          (0.64)
          EAS
          T (0.26)
          (0.74)
          African American - Not Available YRI (Yoruba)
          T (0.02)
          (0.98)
          SAS
          T (0.46)
          (0.54)
          Japanese
          A (0.26)
          (0.74)
          JPT (Japanese)
          T (0.29)
          (0.71)
          AFR
          T (0.04)
          (0.96)
          Chinese
          A (0.27)
          (0.73)
          CHB (Han Chinese)
          T (0.22)
          (0.78)
          EUR
          C (0.38)
          (0.62)
          AMR
          T (0.39)
          (0.61)
          CD3EAP - CD3e molecule associated protein
          There are no transcripts associated with this gene.
          ERCC1 - ERCC excision repair 1, endonuclease non-catalytic subunit
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001166049.1 542 Silent Mutation AAC,AAT N,N 118 NP_001159521.1
          NM_001983.3 542 Silent Mutation AAC,AAT N,N 118 NP_001974.1
          NM_202001.2 542 Silent Mutation AAC,AAT N,N 118 NP_973730.1
          XM_005258634.1 542 Silent Mutation AAC,AAT N,N 118 XP_005258691.1
          XM_005258635.2 542 Silent Mutation AAC,AAT N,N 118 XP_005258692.1
          XM_005258636.4 542 Silent Mutation AAC,AAT N,N 118 XP_005258693.1
          XM_005258637.1 542 Silent Mutation AAC,AAT N,N 118 XP_005258694.1
          XM_011526610.2 542 Silent Mutation AAC,AAT N,N 118 XP_011524912.1
          XM_017026459.1 542 Silent Mutation AAC,AAT N,N 118 XP_016881948.1
          XM_017026460.1 542 Silent Mutation AAC,AAT N,N 118 XP_016881949.1
          XM_017026461.1 542 Silent Mutation AAC,AAT N,N 118 XP_016881950.1
          XM_017026462.1 542 Silent Mutation AAC,AAT N,N 118 XP_016881951.1
          XM_017026463.1 542 Silent Mutation AAC,AAT N,N 118 XP_016881952.1
          XM_017026464.1 542 Silent Mutation AAC,AAT N,N 118 XP_016881953.1
          XM_017026465.1 542 Silent Mutation AAC,AAT N,N 118 XP_016881954.1
          XM_017026466.1 542 Silent Mutation AAC,AAT N,N 118 XP_016881955.1

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Panther Classification:

          Molecular Function -

          endodeoxyribonuclease

          Gene Ontology Categories:

          Function(s) Process(es)

          pyrimidine dimer repair by nucleotide-excision repair
          replicative cell aging
          DNA repair
          transcription-coupled nucleotide-excision repair
          nucleotide-excision repair
          nucleotide-excision repair, preincision complex stabilization
          nucleotide-excision repair, DNA incision, 3'-to lesion
          nucleotide-excision repair, DNA incision, 5'-to lesion
          double-strand break repair
          DNA recombination
          mitotic recombination
          syncytium formation
          response to oxidative stress
          spermatogenesis
          response to nutrient
          cell proliferation
          male gonad development
          UV protection
          response to sucrose
          response to X-ray
          multicellular organism aging
          negative regulation of telomere maintenance
          nucleotide-excision repair, DNA incision
          post-embryonic hemopoiesis
          multicellular organism growth
          interstrand cross-link repair
          isotype switching
          oogenesis
          embryonic organ development
          global genome nucleotide-excision repair
          t-circle formation
          positive regulation of t-circle formation
          single-stranded DNA endodeoxyribonuclease activity
          TFIID-class transcription factor binding
          damaged DNA binding
          single-stranded DNA binding
          protein binding
          protein C-terminus binding
          protein domain specific binding
          structure-specific DNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-fcf5f9d6d-svqt6:80/100.66.77.77:80.
          git-commit: 856de8fa7eff2d55603d92afdf035972e45c3e8a
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.51.0-2026.05.21-1.0