Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___2592038_1_
          See other TMPRSS2 GT Assays ›
          SNP ID:
          rs2070788
          Gene
          TMPRSS2
          Gene Name
          transmembrane protease, serine 2
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.21: 41470061 - 41470061 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          GATTTGTTGTCTGTATGGCCTAGAC[A/G]CTTTTGAGAAGGATATAAACAATAT

          Assay ID C___2592038_1_
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602060

          Literature Links:

          TMPRSS2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.40)
          (0.60)
          Caucasian
          G (0.43)
          (0.57)
          CEPH (CEU)
          C (0.50)
          (0.50)
          EAS
          C (0.36)
          (0.64)
          African American
          G (0.23)
          (0.77)
          YRI (Yoruba)
          C (0.34)
          (0.66)
          SAS
          C (0.47)
          (0.53)
          Chinese - Not Available JPT (Japanese)
          C (0.30)
          (0.70)
          AFR
          C (0.27)
          (0.73)
          Japanese - Not Available CHB (Han Chinese)
          C (0.32)
          (0.68)
          EUR
          C (0.46)
          (0.54)
          AMR
          C (0.49)
          (0.51)
          TMPRSS2 - transmembrane protease, serine 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001135099.1 Intron NP_001128571.1
          NM_005656.3 Intron NP_005647.3
          XM_005261043.2 Intron XP_005261100.1
          XM_011529731.2 Intron XP_011528033.1
          XM_011529732.2 Intron XP_011528034.1
          XM_011529733.1 Intron XP_011528035.1

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Panther Classification:

          Molecular Function -

          serine protease

          Gene Ontology Categories:

          Function(s) Process(es)

          proteolysis
          receptor-mediated endocytosis
          protein autoprocessing
          positive regulation of viral entry into host cell
          serine-type endopeptidase activity
          scavenger receptor activity
          protein binding
          serine-type peptidase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-5799cd5976-2rlvt:80/100.66.78.131:80.
          git-commit: e30ab741173a2eb62411af663260592d4bdb9634
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.55.0-2026.07.30-1.0