Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___2700868_10
          See other RALGPS1 GT Assays ›
          SNP ID:
          rs943804
          Gene
          RALGPS1
          Gene Name
          Ral GEF with PH domain and SH3 binding motif 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.9: 126985638 - 126985638 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          GAATATTACTACTAAGCAGTAGACT[A/G]CTGGTCAAATTTTAACATTTTCTTG

          Assay ID C___2700868_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 614444

          Literature Links:

          RALGPS1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.42)
          (0.58)
          Caucasian - Not Available CEPH (CEU)
          G (0.25)
          (0.75)
          EAS
          G (0.18)
          (0.82)
          African American - Not Available YRI (Yoruba)
          A (0.15)
          (0.85)
          SAS
          G (0.21)
          (0.79)
          Chinese - Not Available JPT (Japanese)
          G (0.35)
          (0.65)
          AFR
          A (0.14)
          (0.86)
          Japanese - Not Available CHB (Han Chinese)
          G (0.21)
          (0.79)
          EUR
          G (0.27)
          (0.73)
          AMR
          G (0.44)
          (0.56)
          RALGPS1 - Ral GEF with PH domain and SH3 binding motif 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001190728.1 Intron NP_001177657.1
          NM_001190729.1 Intron NP_001177658.1
          NM_001190730.1 Intron NP_001177659.1
          NM_001322320.1 Intron NP_001309249.1
          NM_001322321.1 Intron NP_001309250.1
          NM_001322322.1 Intron NP_001309251.1
          NM_001322323.1 Intron NP_001309252.1
          NM_001322324.1 Intron NP_001309253.1
          NM_001322325.1 Intron NP_001309254.1
          NM_014636.2 Intron NP_055451.1
          XM_006717328.3 Intron XP_006717391.2
          XM_011519225.1 Intron XP_011517527.1
          XM_011519226.1 Intron XP_011517528.1
          XM_011519227.1 Intron XP_011517529.1
          XM_011519228.1 Intron XP_011517530.1
          XM_011519229.1 Intron XP_011517531.1
          XM_011519230.2 Intron XP_011517532.1
          XM_011519231.1 Intron XP_011517533.1
          XM_011519232.1 Intron XP_011517534.1
          XM_011519233.1 Intron XP_011517535.1
          XM_011519234.2 Intron XP_011517536.1
          XM_011519235.2 Intron XP_011517537.1
          XM_011519236.1 Intron XP_011517538.1
          XM_011519238.2 Intron XP_011517540.1
          XM_017015342.1 Intron XP_016870831.1
          XM_017015343.1 Intron XP_016870832.1
          XM_017015344.1 Intron XP_016870833.1
          XM_017015345.1 Intron XP_016870834.1
          XM_017015346.1 Intron XP_016870835.1
          XM_017015347.1 Intron XP_016870836.1
          XM_017015348.1 Intron XP_016870837.1
          XM_017015349.1 Intron XP_016870838.1
          XM_017015350.1 Intron XP_016870839.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          guanyl-nucleotide exchange factor

          Gene Ontology Categories:

          Function(s) Process(es)

          small GTPase mediated signal transduction
          regulation of Ral protein signal transduction
          intracellular signal transduction
          positive regulation of GTPase activity
          guanyl-nucleotide exchange factor activity
          Ral guanyl-nucleotide exchange factor activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline