Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Pipettes and Pipette Tips
    • Lab Centrifuges
    • Ultra-Low Temperature Freezers
    • Spectroscopy
    • Beakers
    • PCR Equipment and Supplies
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all product categories
  • Applications
    • Cell Analysis
    • Lab Equipment
    • Real-Time PCR
    • PCR
    • Chromatography
    • Cell Culture and Transfection
    • DNA and RNA Extraction and Analysis
    • Protein Biology
    • Flow Cytometry
    • Chemicals
    • See all applications and techniques
  • Services
    • Custom Services
    • Lab Informatics
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Instrument Services
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • Customer Center
    • Contact Us
    • Certificates of Analysis and Conformance
    • Safety Data Sheets (SDS)
    • Manuals
    • How to Cite Our Products in a Paper
    • Instrument Support
    • Knowledge Base and Product FAQs
    • Learning Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___2817734_1_
          See other EPB41L2 GT Assays ›
          SNP ID:
          rs2281490
          Gene
          EPB41L2 SMLR1
          Gene Name
          erythrocyte membrane protein band 4.1 like 2
          small leucine rich protein 1
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.6: 130831711 - 130831711 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          GGTTATGGCAAATGTAATCATTTCT[A/G]TTTTATTCCTGTAAAGAGAGGGACA

          Assay ID C___2817734_1_
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603237

          Literature Links:

          EPB41L2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.45)
          (0.55)
          Caucasian
          A (0.36)
          (0.64)
          CEPH (CEU)
          A (0.31)
          (0.69)
          EAS
          G (0.32)
          (0.68)
          African American
          A (0.28)
          (0.72)
          YRI (Yoruba)
          A (0.33)
          (0.67)
          SAS
          G (0.49)
          (0.51)
          Japanese
          G (0.32)
          (0.68)
          JPT (Japanese)
          G (0.36)
          (0.64)
          AFR
          A (0.37)
          (0.63)
          Chinese
          G (0.30)
          (0.70)
          CHB (Han Chinese)
          G (0.27)
          (0.73)
          EUR
          A (0.31)
          (0.69)
          AMR
          A (0.40)
          (0.60)
          EPB41L2 - erythrocyte membrane protein band 4.1 like 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001135554.1 3370 Intron NP_001129026.1
          NM_001135555.3 3370 Intron NP_001129027.1
          NM_001199388.2 3370 Intron NP_001186317.1
          NM_001252660.1 3370 Intron NP_001239589.1
          NM_001431.3 3370 Intron NP_001422.1
          XM_006715362.2 3370 Intron XP_006715425.1
          XM_011535524.1 3370 Intron XP_011533826.1
          XM_011535525.1 3370 Intron XP_011533827.1
          XM_011535527.1 3370 Intron XP_011533829.1
          XM_011535528.1 3370 Intron XP_011533830.1
          XM_011535529.1 3370 Intron XP_011533831.1
          XM_011535530.1 3370 Intron XP_011533832.1
          XM_011535534.1 3370 Intron XP_011533836.1
          XM_011535536.1 3370 Intron XP_011533838.1
          XM_017010349.1 3370 Intron XP_016865838.1
          XM_017010350.1 3370 Intron XP_016865839.1
          XM_017010351.1 3370 Intron XP_016865840.1
          XM_017010352.1 3370 Intron XP_016865841.1
          XM_017010353.1 3370 UTR 3 XP_016865842.1
          XM_017010354.1 3370 Intron XP_016865843.1
          XM_017010355.1 3370 Intron XP_016865844.1
          XM_017010356.1 3370 Intron XP_016865845.1
          XM_017010357.1 3370 Intron XP_016865846.1
          XM_017010358.1 3370 Intron XP_016865847.1
          XM_017010359.1 3370 Intron XP_016865848.1
          XM_017010360.1 3370 Intron XP_016865849.1
          XM_017010361.1 3370 Intron XP_016865850.1
          XM_017010362.1 3370 Intron XP_016865851.1
          XM_017010363.1 3370 Intron XP_016865852.1
          XM_017010364.1 3370 Intron XP_016865853.1
          SMLR1 - small leucine rich protein 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001195597.1 3370 Intron NP_001182526.1

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Gene Ontology Categories:

          Function(s) Process(es)

          cortical actin cytoskeleton organization
          actin binding
          structural molecule activity
          spectrin binding
          PH domain binding
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Fair Trade Fair Trade
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Customer Help Desk | working day 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          Service Call Center | working day 09:00~18:00
          1661-5055   |   Live Chat

          Thermo Fisher Scientific Korea Ltd.
          Representative : Soojin Seok
          Company Registration No. : 117-81-46910

           

          Thermo Fisher Scientific Solutions LLC
          Representative : Soojin Seok
          Company Registration No. : 114-86-04783

           

          Location: 12F Suseo Office Building, 281 Gwangpyeong-ro, Gangnam-gu, Seoul, Korea(06349) | Mail-Order Business Registration : 2015-Seoul Gangnam-00898 | Payment : ShinHan Bank 140-004-396660 (Thermo Fisher Scientific Solutions LLC)

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-green-6479c7f679-vvlg5:80/100.66.78.195:80.
          git-commit: b70c0dceb888abc3b0dcebb5bc3a5b8753e7e816
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.50.0-Offline