Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___2910318_10
          See other ADIPOQ GT Assays ›
          SNP ID:
          rs822394
          Gene
          ADIPOQ ADIPOQ-AS1
          Gene Name
          adiponectin, C1Q and collagen domain containing
          ADIPOQ antisense RNA 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.3: 186848939 - 186848939 on Build GRCh38
          Polymorphism:
          A/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          AACTTCTGAGGCTCCTGTGCTAATC[A/C]CACTCTTGTATTTTTGGCACCTCTA

          Assay ID C___2910318_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605441

          Literature Links:

          ADIPOQ PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.12)
          (0.88)
          Caucasian - Not Available CEPH (CEU)
          A (0.14)
          (0.86)
          EAS
          A (0.12)
          (0.88)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.20)
          (0.80)
          Chinese - Not Available JPT (Japanese)
          A (0.05)
          (0.95)
          AFR
          A (0.01)
          (0.99)
          Japanese - Not Available CHB (Han Chinese)
          A (0.10)
          (0.90)
          EUR
          A (0.18)
          (0.82)
          AMR
          A (0.16)
          (0.84)
          ADIPOQ - adiponectin, C1Q and collagen domain containing
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001177800.1 Intron NP_001171271.1
          NM_004797.3 Intron NP_004788.1
          ADIPOQ-AS1 - ADIPOQ antisense RNA 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          response to hypoxia
          positive regulation of protein phosphorylation
          glucose metabolic process
          generation of precursor metabolites and energy
          fatty acid beta-oxidation
          response to nutrient
          circadian rhythm
          response to sucrose
          response to glucose
          positive regulation of signal transduction
          negative regulation of platelet-derived growth factor receptor signaling pathway
          positive regulation of protein kinase A signaling
          negative regulation of macrophage derived foam cell differentiation
          negative regulation of tumor necrosis factor-mediated signaling pathway
          positive regulation of cholesterol efflux
          regulation of glucose metabolic process
          response to activity
          negative regulation of smooth muscle cell migration
          fatty acid oxidation
          negative regulation of cell migration
          negative regulation of granulocyte differentiation
          negative regulation of protein autophosphorylation
          positive regulation of cellular protein metabolic process
          negative regulation of tumor necrosis factor production
          positive regulation of interleukin-8 production
          cellular response to insulin stimulus
          positive regulation of myeloid cell apoptotic process
          adiponectin-activated signaling pathway
          negative regulation of heterotypic cell-cell adhesion
          low-density lipoprotein particle clearance
          response to tumor necrosis factor
          cellular response to drug
          glucose homeostasis
          positive regulation of I-kappaB kinase/NF-kappaB signaling
          negative regulation of I-kappaB kinase/NF-kappaB signaling
          negative regulation of MAP kinase activity
          response to ethanol
          negative regulation of fat cell differentiation
          negative regulation of macrophage differentiation
          negative regulation of low-density lipoprotein particle receptor biosynthetic process
          negative regulation of gluconeogenesis
          negative regulation of blood pressure
          positive regulation of blood pressure
          negative regulation of transcription, DNA-templated
          positive regulation of fatty acid metabolic process
          positive regulation of glucose import
          negative regulation of hormone secretion
          negative regulation of smooth muscle cell proliferation
          negative regulation of inflammatory response
          positive regulation of peptidyl-tyrosine phosphorylation
          negative regulation of phagocytosis
          negative regulation of synaptic transmission
          brown fat cell differentiation
          protein homooligomerization
          response to glucocorticoid
          membrane depolarization
          membrane hyperpolarization
          protein heterotrimerization
          negative regulation of ERK1 and ERK2 cascade
          response to linoleic acid
          detection of oxidative stress
          cellular response to cAMP
          positive regulation of monocyte chemotactic protein-1 production
          cellular response to epinephrine stimulus
          protein localization to plasma membrane
          negative regulation of intracellular protein transport
          negative regulation of receptor binding
          negative regulation of DNA biosynthetic process
          positive regulation of glycogen (starch) synthase activity
          positive regulation of metanephric glomerular visceral epithelial cell development
          positive regulation of cAMP-dependent protein kinase activity
          positive regulation of renal albumin absorption
          negative regulation of platelet-derived growth factor receptor-alpha signaling pathway
          negative regulation of metanephric mesenchymal cell migration
          receptor binding
          cytokine activity
          hormone activity
          protein binding
          sialic acid binding
          identical protein binding
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-fbg7s:80/100.66.79.246:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline