Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___3042197_1_
          See other HTR2A GT Assays ›
          SNP ID:
          rs6313
          Gene
          HTR2A
          Gene Name
          5-hydroxytryptamine receptor 2A
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.13: 46895805 - 46895805 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          ATGCATCAGAAGTGTTAGCTTCTCC[A/G]GAGTTAAAGTCATTACTGTAGAGCC

          Assay ID C___3042197_1_
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 182135

          Literature Links:

          HTR2A PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.44)
          (0.56)
          Caucasian
          A (0.42)
          (0.58)
          CEPH (CEU)
          T (0.47)
          (0.53)
          EAS
          C (0.41)
          (0.59)
          African American
          A (0.43)
          (0.57)
          YRI (Yoruba)
          T (0.38)
          (0.62)
          SAS
          T (0.42)
          (0.58)
          Japanese
          G (0.46)
          (0.54)
          JPT (Japanese)
          C (0.49)
          (0.51)
          AFR
          T (0.39)
          (0.61)
          Chinese
          G (0.23)
          (0.77)
          CHB (Han Chinese)
          T (0.48)
          (0.52)
          EUR
          T (0.44)
          (0.56)
          AMR
          T (0.35)
          (0.65)
          HTR2A - 5-hydroxytryptamine receptor 2A
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000621.4 833 Silent Mutation TCC,TCT S,S 34 NP_000612.1
          NM_001165947.2 833 Intron NP_001159419.1

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Panther Classification:

          Molecular Function -

          G-protein coupled receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          temperature homeostasis
          cellular calcium ion homeostasis
          activation of phospholipase C activity
          phospholipase C-activating serotonin receptor signaling pathway
          serotonin receptor signaling pathway
          chemical synaptic transmission
          aging
          memory
          cell death
          positive regulation of cell proliferation
          positive regulation of phosphatidylinositol biosynthetic process
          regulation of dopamine secretion
          phosphatidylinositol 3-kinase signaling
          artery smooth muscle contraction
          urinary bladder smooth muscle contraction
          sleep
          response to drug
          negative regulation of potassium ion transport
          positive regulation of MAP kinase activity
          protein localization to cytoskeleton
          positive regulation of fat cell differentiation
          positive regulation of glycolytic process
          positive regulation of vasoconstriction
          viral entry into host cell
          regulation of hormone secretion
          behavioral response to cocaine
          positive regulation of peptidyl-tyrosine phosphorylation
          regulation of behavior
          detection of temperature stimulus involved in sensory perception of pain
          detection of mechanical stimulus involved in sensory perception of pain
          release of sequestered calcium ion into cytosol
          negative regulation of synaptic transmission, glutamatergic
          positive regulation of ERK1 and ERK2 cascade
          virus receptor activity
          G-protein alpha-subunit binding
          G-protein coupled serotonin receptor activity
          drug binding
          protein complex binding
          serotonin binding
          1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-vzwvz:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline