Hamburger Menu Button
Thermo Fisher Scientific Logo
로그인
회원이 아니신가요? 계정 생성하기
  • 모든 제품 주문
    • 항체
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR 분석
    • 피펫 및 피펫 팁
    • 실험실용 원심분리기
    • 초저온 냉동고
    • 분광학
    • 비이커
    • PCR 장비 및 용품
    • 제품 카테고리 전체보기
  • 응용 분야 및 기법
    • 세포 분석
    • 실험실 장비
    • Real-Time PCR
    • PCR
    • 크로마토그래피
    • 세포 배양 및 트랜스펙션
    • DNA/RNA 추출과 분석
    • 단백질 생물학
    • 유세포분석
    • 화학 제품
    • 응용 분야 및 기법 전체보기
  • 서비스
    • 맞춤형 서비스
    • 엔터프라이즈급 실험실 정보 처리
    • 360° CDMO 및 CRO 서비스
    • CDMO 서비스
    • 임상시험 CRO 서비스
    • 장비 서비스
    • 교육 서비스
    • Unity Lab Services
    • 서비스 전체 보기
  • 지원
    • 고객센터
    • 문의하기
    • 시험성적서(COA) 및 적합성 인증서(COC)
    • Safety Data Sheets (SDS)
    • 매뉴얼
    • 인용 및 참고 문헌
    • 기기 지원
    • 기술 자료/제품 FAQ
    • 학습 센터
    • 지원 메뉴 전체보기
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • 문의하기
  • 빠른 주문
  • 주문 현황
  • 제품 문서 검색
Thermo Fisher Scientific Logo

Search

전체검색
Search button
          • 주문 현황
          • 빠른주문
          • 로그인
            로그인
            회원이 아니신가요? 계정 생성하기
            • 계정정보
            • 주문내역조회
            • 커스텀제품 및 프로젝트
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___3084793_20
          See other APOC1 GT Assays ›
          SNP ID:
          rs429358
          Gene
          APOC1 APOE TOMM40
          Gene Name
          apolipoprotein C1
          apolipoprotein E
          translocase of outer mitochondrial membrane 40
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.19: 44908684 - 44908684 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          GCTGGGCGCGGACATGGAGGACGTG[C/T]GCGGCCGCCTGGTGCAGTACCGCGG

          Assay ID C___3084793_20
          Size
          재고 정보 주문접수 후 제작
          Catalog # 4351379
          제품 정가
          Your Price
          온라인 행사가:
          공급가 확인 ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay 상세 정보



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 107710 MIM: 107741 MIM: 608061

          Literature Links:

          APOC1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.15)
          (0.85)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          C (0.09)
          (0.91)
          African American - Not Available YRI (Yoruba)
          C (0.02)
          (0.98)
          SAS
          C (0.09)
          (0.91)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          C (0.27)
          (0.73)
          Japanese - Not Available JPT (Japanese)
          C (0.01)
          (0.99)
          EUR
          C (0.16)
          (0.84)
          AMR
          C (0.10)
          (0.90)
          APOC1 - apolipoprotein C1
          There are no transcripts associated with this gene.
          APOE - apolipoprotein E
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000041.3 586 Missense Mutation CGC,TGC R,C 130 NP_000032.1
          NM_001302688.1 586 Missense Mutation CGC,TGC R,C 156 NP_001289617.1
          NM_001302689.1 586 Missense Mutation CGC,TGC R,C 130 NP_001289618.1
          NM_001302690.1 586 Missense Mutation CGC,TGC R,C 130 NP_001289619.1
          NM_001302691.1 586 Missense Mutation CGC,TGC R,C 130 NP_001289620.1
          TOMM40 - translocase of outer mitochondrial membrane 40
          There are no transcripts associated with this gene.

          Back To Top

          추가 정보


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          apolipoprotein

          Gene Ontology Categories:

          Function(s) Process(es)

          response to reactive oxygen species
          retinoid metabolic process
          negative regulation of endothelial cell proliferation
          response to dietary excess
          triglyceride metabolic process
          cholesterol catabolic process
          cellular calcium ion homeostasis
          receptor-mediated endocytosis
          cytoskeleton organization
          G-protein coupled receptor signaling pathway
          nitric oxide mediated signal transduction
          synaptic transmission, cholinergic
          cholesterol metabolic process
          regulation of gene expression
          negative regulation of platelet activation
          positive regulation of cholesterol esterification
          positive regulation of cholesterol efflux
          long-chain fatty acid transport
          protein import
          virion assembly
          triglyceride catabolic process
          cGMP-mediated signaling
          negative regulation of blood coagulation
          regulation of axon extension
          positive regulation of cGMP biosynthetic process
          neuron projection regeneration
          regulation of Cdc42 protein signal transduction
          positive regulation of low-density lipoprotein particle receptor catabolic process
          cholesterol efflux
          phospholipid efflux
          very-low-density lipoprotein particle remodeling
          low-density lipoprotein particle remodeling
          high-density lipoprotein particle remodeling
          high-density lipoprotein particle assembly
          chylomicron remnant clearance
          high-density lipoprotein particle clearance
          very-low-density lipoprotein particle clearance
          lipoprotein metabolic process
          lipoprotein biosynthetic process
          lipoprotein catabolic process
          vasodilation
          cholesterol homeostasis
          negative regulation of MAP kinase activity
          negative regulation of neuron apoptotic process
          negative regulation of blood vessel endothelial cell migration
          reverse cholesterol transport
          positive regulation by host of viral process
          negative regulation of cholesterol biosynthetic process
          positive regulation of lipid biosynthetic process
          intracellular transport
          regulation of neuronal synaptic plasticity
          artery morphogenesis
          negative regulation of inflammatory response
          positive regulation of nitric-oxide synthase activity
          positive regulation of membrane protein ectodomain proteolysis
          maintenance of location in cell
          fatty acid homeostasis
          positive regulation of dendritic spine development
          negative regulation of canonical Wnt signaling pathway
          AMPA glutamate receptor clustering
          NMDA glutamate receptor clustering
          cellular oxidant detoxification
          regulation of beta-amyloid clearance
          negative regulation of neuron death
          positive regulation of postsynaptic membrane organization
          negative regulation of presynaptic membrane organization
          negative regulation of beta-amyloid formation
          positive regulation of dendritic spine maintenance
          positive regulation of phospholipid efflux
          positive regulation of lipid transport across blood brain barrier
          beta-amyloid binding
          lipid transporter activity
          protein binding
          phospholipid binding
          heparin binding
          lipid binding
          cholesterol binding
          antioxidant activity
          cholesterol transporter activity
          identical protein binding
          protein homodimerization activity
          metal chelating activity
          tau protein binding
          low-density lipoprotein particle receptor binding
          phosphatidylcholine-sterol O-acyltransferase activator activity
          very-low-density lipoprotein particle receptor binding
          lipoprotein particle binding

          Back To Top

          관련 제품

          • TaqMan® Genotyping Master Mix
          온라인 주문 Plus Icon Minus Icon
          • 주문 현황
          • 주문 지원
          • 빠른 주문
          • Supply Center
          • eProcurement
          지원 Plus Icon Minus Icon
          • Help and Support
          • 고객 센터
          • 기술 지원 센터
          • 제품 문서 검색
          • 사이트 문제 보고
          교육 및 이벤트 Plus Icon Minus Icon
          • 교육 센터
          • 프로모션
          • 이벤트 및 웨비나
          • 소셜 미디어
          About Thermo Fisher Plus Icon Minus Icon
          • 소개 소개
          • 채용 채용
          • 투자자 투자자
          • 뉴스 뉴스
          • 사회적 책임 사회적 책임
          • Trademarks
          • 공정거래 공정거래
          • 정책 및 고지
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • 이용 약관
          • 개인정보 처리방침
          • 가격 및 운임 정책
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          써모 피셔 사이언티픽 코리아 주식회사
          대표자 : 석수진
          사업자 등록번호 : 117-81-46910
          입금계좌 : 하나은행 336-890014-06204
          (예금주 : 써모피셔사이언티픽코리아 주식회사)

           

          써모 피셔 사이언티픽 솔루션스 유한회사
          대표자 : 석수진
          사업자 등록번호 : 114-86-04783
          입금계좌 : 신한은행 140-004-396660
          (예금주 : 써모피셔사이언티픽솔루션스 유한회사)

           

          주소 : 서울시 강남구 광평로 281 수서오피스빌딩 12층 06349 | 통신판매업신고번호 : 2015-서울강남-00898

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-green-7d94cb4b65-mrft7:80/100.66.76.145:80.
          git-commit: c9e08c96761173abe34e68f880379696776a4827
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.44.1-2026.02.97.1.0