Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___3099976_30
          See other CYP1B1 GT Assays ›
          SNP ID:
          rs1056836
          Gene
          CYP1B1 RMDN2
          Gene Name
          cytochrome P450 family 1 subfamily B member 1
          regulator of microtubule dynamics 2
          Set Membership:
          > HapMap > DME > Validated > Inventoried
          Chromosome Location:
          Chr.2: 38071060 - 38071060 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          AAGTTCTCCGGGTTAGGCCACTTCA[C/G]TGGGTCATGATTCACAGACCACTGG

          Assay ID C___3099976_30
          Size 150 rxns
          Availability Inventoried
          Catalog # 4362691
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 601771 MIM: 611872

          Literature Links:

          CYP1B1 PubMed Links

          Allele Nomenclature:

          CYP1B1*3,g.4326C>G CYP1B1*5,g.4326C>G CYP1B1*6,g.4326C>G CYP1B1*7,g.4326C>G

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.39)
          (0.61)
          Caucasian
          G (0.49)
          (0.51)
          CEPH (CEU)
          G (0.45)
          (0.55)
          EAS
          C (0.09)
          (0.91)
          African American
          G (0.28)
          (0.72)
          YRI (Yoruba)
          C (0.12)
          (0.88)
          SAS
          G (0.17)
          (0.83)
          Japanese
          C (0.18)
          (0.82)
          JPT (Japanese)
          G (0.10)
          (0.90)
          AFR
          G (0.18)
          (0.82)
          Chinese
          C (0.09)
          (0.91)
          CHB (Han Chinese)
          G (0.13)
          (0.87)
          EUR
          C (0.40)
          (0.60)
          AMR
          G (0.28)
          (0.72)
          CYP1B1 - cytochrome P450 family 1 subfamily B member 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000104.3 1697 Missense Mutation CTG,GTG L,V 432 NP_000095.2
          RMDN2 - regulator of microtubule dynamics 2
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap DME Validated Inventoried

          Gene Ontology Categories:

          Function(s) Process(es)

          angiogenesis
          trabecular meshwork development
          cellular aromatic compound metabolic process
          xenobiotic metabolic process
          nitric oxide biosynthetic process
          cell adhesion
          visual perception
          steroid metabolic process
          estrogen metabolic process
          negative regulation of cell proliferation
          intrinsic apoptotic signaling pathway in response to oxidative stress
          toxin metabolic process
          response to toxic substance
          positive regulation of vascular endothelial growth factor production
          sterol metabolic process
          arachidonic acid metabolic process
          epoxygenase P450 pathway
          collagen fibril organization
          negative regulation of cell migration
          negative regulation of NF-kappaB transcription factor activity
          negative regulation of cell adhesion mediated by integrin
          retinol metabolic process
          retinal metabolic process
          positive regulation of apoptotic process
          endothelial cell migration
          positive regulation of angiogenesis
          positive regulation of JAK-STAT cascade
          membrane lipid catabolic process
          blood vessel morphogenesis
          oxidation-reduction process
          retinal blood vessel morphogenesis
          cellular response to hydrogen peroxide
          cellular response to organic cyclic compound
          endothelial cell-cell adhesion
          omega-hydroxylase P450 pathway
          regulation of reactive oxygen species metabolic process
          monooxygenase activity
          iron ion binding
          oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
          oxygen binding
          heme binding
          aromatase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-vzwvz:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline