Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___3163590_10
          See other ESR1 GT Assays ›
          SNP ID:
          rs2234693
          Gene
          ESR1
          Gene Name
          estrogen receptor 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.6: 151842200 - 151842200 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TCATCTGAGTTCCAAATGTCCCAGC[C/T]GTTTTATGCTTTGTCTCTGTTTCCC

          Assay ID C___3163590_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 133430

          Literature Links:

          ESR1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.45)
          (0.55)
          Caucasian - Not Available CEPH (CEU)
          C (0.41)
          (0.59)
          EAS
          C (0.40)
          (0.60)
          African American - Not Available YRI (Yoruba)
          C (0.50)
          (0.50)
          SAS
          C (0.42)
          (0.58)
          Chinese - Not Available JPT (Japanese)
          C (0.39)
          (0.61)
          AFR
          T (0.43)
          (0.57)
          Japanese - Not Available CHB (Han Chinese)
          C (0.42)
          (0.58)
          EUR
          C (0.42)
          (0.58)
          AMR
          C (0.35)
          (0.65)
          ESR1 - estrogen receptor 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000125.3 Intron NP_000116.2
          NM_001122740.1 Intron NP_001116212.1
          NM_001122741.1 Intron NP_001116213.1
          NM_001122742.1 Intron NP_001116214.1
          NM_001291230.1 Intron NP_001278159.1
          NM_001291241.1 Intron NP_001278170.1
          NM_001328100.1 Intron NP_001315029.1
          XM_006715374.3 Intron XP_006715437.1
          XM_006715375.3 Intron XP_006715438.1
          XM_011535543.2 Intron XP_011533845.1
          XM_011535544.2 Intron XP_011533846.1
          XM_011535545.2 Intron XP_011533847.1
          XM_011535547.2 Intron XP_011533849.1
          XM_011535549.2 Intron XP_011533851.1
          XM_017010376.1 Intron XP_016865865.1
          XM_017010377.1 Intron XP_016865866.1
          XM_017010378.1 Intron XP_016865867.1
          XM_017010379.1 Intron XP_016865868.1
          XM_017010380.1 Intron XP_016865869.1
          XM_017010381.1 Intron XP_016865870.1
          XM_017010382.1 Intron XP_016865871.1
          XM_017010383.1 Intron XP_016865872.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          antral ovarian follicle growth
          osteoblast development
          chromatin remodeling
          transcription, DNA-templated
          regulation of transcription, DNA-templated
          transcription from RNA polymerase II promoter
          transcription initiation from RNA polymerase II promoter
          signal transduction
          phospholipase C-activating G-protein coupled receptor signaling pathway
          positive regulation of cytosolic calcium ion concentration
          androgen metabolic process
          negative regulation of gene expression
          positive regulation of phospholipase C activity
          intracellular steroid hormone receptor signaling pathway
          intracellular estrogen receptor signaling pathway
          response to estradiol
          negative regulation of I-kappaB kinase/NF-kappaB signaling
          negative regulation of sequence-specific DNA binding transcription factor activity
          regulation of neuron apoptotic process
          response to estrogen
          positive regulation of epidermal growth factor receptor signaling pathway
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          negative regulation of glucose import
          decidualization
          positive regulation of fibroblast proliferation
          negative regulation of smooth muscle cell proliferation
          positive regulation of epithelial cell proliferation
          positive regulation of sequence-specific DNA binding transcription factor activity
          Sertoli cell development
          Sertoli cell proliferation
          uterus development
          vagina development
          prostate epithelial cord elongation
          prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis
          regulation of branching involved in prostate gland morphogenesis
          mammary gland branching involved in pregnancy
          mammary gland alveolus development
          epithelial cell proliferation involved in mammary gland duct elongation
          positive regulation of ERK1 and ERK2 cascade
          protein localization to chromatin
          cellular response to estrogen stimulus
          cellular response to estradiol stimulus
          negative regulation of triglyceride metabolic process
          negative regulation of neuron death
          negative regulation of production of miRNAs involved in gene silencing by miRNA
          baculum development
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          core promoter sequence-specific DNA binding
          transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding
          transcription coactivator binding
          chromatin binding
          transcription factor activity, sequence-specific DNA binding
          steroid hormone receptor activity
          steroid binding
          protein binding
          beta-catenin binding
          transcription factor binding
          zinc ion binding
          enzyme binding
          nitric-oxide synthase regulator activity
          estrogen receptor activity
          type 1 metabotropic glutamate receptor binding
          protein complex binding
          estrogen response element binding
          phosphatidylinositol 3-kinase regulatory subunit binding
          RNA polymerase II transcription factor activity, estrogen-activated sequence-specific DNA binding
          hormone binding
          identical protein binding
          ATPase binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline