Hamburger Menu Button
Thermo Fisher Scientific Logo
로그인
회원이 아니신가요? 계정 생성하기
  • 모든 제품 주문
    • 항체
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR 분석
    • 피펫 및 피펫 팁
    • 실험실용 원심분리기
    • 초저온 냉동고
    • 분광학
    • 비이커
    • PCR 장비 및 용품
    • 제품 카테고리 전체보기
  • 응용 분야 및 기법
    • 세포 분석
    • 실험실 장비
    • Real-Time PCR
    • PCR
    • 크로마토그래피
    • 세포 배양 및 트랜스펙션
    • DNA/RNA 추출과 분석
    • 단백질 생물학
    • 유세포분석
    • 화학 제품
    • 응용 분야 및 기법 전체보기
  • 서비스
    • 맞춤형 서비스
    • 엔터프라이즈급 실험실 정보 처리
    • 360° CDMO 및 CRO 서비스
    • CDMO 서비스
    • 임상시험 CRO 서비스
    • 장비 서비스
    • 교육 서비스
    • Unity Lab Services
    • 서비스 전체 보기
  • 지원
    • 고객센터
    • 문의하기
    • 시험성적서(COA) 및 적합성 인증서(COC)
    • Safety Data Sheets (SDS)
    • 매뉴얼
    • 인용 및 참고 문헌
    • 기기 지원
    • 기술 자료/제품 FAQ
    • 학습 센터
    • 지원 메뉴 전체보기
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • 문의하기
  • 빠른 주문
  • 주문 현황
  • 제품 문서 검색
Thermo Fisher Scientific Logo

Search

전체검색
Search button
          • 주문 현황
          • 빠른주문
          • 로그인
            로그인
            회원이 아니신가요? 계정 생성하기
            • 계정정보
            • 주문내역조회
            • 커스텀제품 및 프로젝트
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___3290335_20
          See other OXTR GT Assays ›
          SNP ID:
          rs53576
          Gene
          OXTR
          Gene Name
          oxytocin receptor
          Set Membership:
          -
          Chromosome Location:
          Chr.3: 8762685 - 8762685 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AAAGGTGTACGGGACATGCCCGAGG[A/G]TCCTCAGTCCCACAGAAACAGGGAG

          Assay ID C___3290335_20
          Size
          재고 정보 주문접수 후 제작
          Catalog # 4351379
          제품 정가
          Your Price
          온라인 행사가:
          공급가 확인 ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay 상세 정보



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 167055

          Literature Links:

          OXTR PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.39)
          (0.61)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          G (0.35)
          (0.65)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.45)
          (0.55)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.19)
          (0.81)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.35)
          (0.65)
          AMR
          A (0.36)
          (0.64)
          OXTR - oxytocin receptor
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000916.3 Intron NP_000907.2
          XM_011533762.2 Intron XP_011532064.1

          Back To Top

          추가 정보


          Panther Classification:

          Molecular Function -

          G-protein coupled receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          suckling behavior
          response to amphetamine
          regulation of systemic arterial blood pressure by vasopressin
          muscle contraction
          cell surface receptor signaling pathway
          G-protein coupled receptor signaling pathway
          positive regulation of cytosolic calcium ion concentration
          heart development
          female pregnancy
          lactation
          memory
          positive regulation of norepinephrine secretion
          telencephalon development
          sleep
          positive regulation of synaptic transmission, GABAergic
          response to estradiol
          response to progesterone
          cellular response to hormone stimulus
          response to anoxia
          response to cytokine
          social behavior
          response to cocaine
          response to drug
          maternal behavior
          sperm ejaculation
          eating behavior
          response to peptide hormone
          estrous cycle
          positive regulation of blood pressure
          positive regulation of vasoconstriction
          digestive tract development
          positive regulation of synapse assembly
          positive regulation of synaptic transmission, glutamatergic
          maternal process involved in parturition
          positive regulation of penile erection
          negative regulation of gastric acid secretion
          ERK1 and ERK2 cascade
          positive regulation of uterine smooth muscle contraction
          response to peptide
          oxytocin receptor activity
          vasopressin receptor activity
          peptide hormone binding
          peptide binding

          Back To Top

          관련 제품

          • TaqMan® Genotyping Master Mix
          온라인 주문 Plus Icon Minus Icon
          • 주문 현황
          • 주문 지원
          • 빠른 주문
          • Supply Center
          • eProcurement
          지원 Plus Icon Minus Icon
          • Help and Support
          • 고객 센터
          • 기술 지원 센터
          • 제품 문서 검색
          • 사이트 문제 보고
          교육 및 이벤트 Plus Icon Minus Icon
          • 교육 센터
          • 프로모션
          • 이벤트 및 웨비나
          • 소셜 미디어
          About Thermo Fisher Plus Icon Minus Icon
          • 소개 소개
          • 채용 채용
          • 투자자 투자자
          • 뉴스 뉴스
          • 사회적 책임 사회적 책임
          • Trademarks
          • 공정거래 공정거래
          • 정책 및 고지
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • 이용 약관
          • 개인정보 처리방침
          • 가격 및 운임 정책
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Korea flag icon
          Korea

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          고객센터 문의 | 평일 09:00~18:00
          1661-9555   |   Live Chat   |   카카오톡 상담

           

          장비 서비스 문의 | 평일 09:00~18:00
          1661-5055   |   Live Chat

          써모 피셔 사이언티픽 코리아 주식회사
          대표자 : 석수진
          사업자 등록번호 : 117-81-46910
          입금계좌 : 하나은행 336-890014-06204
          (예금주 : 써모피셔사이언티픽코리아 주식회사)

           

          써모 피셔 사이언티픽 솔루션스 유한회사
          대표자 : 석수진
          사업자 등록번호 : 114-86-04783
          입금계좌 : 신한은행 140-004-396660
          (예금주 : 써모피셔사이언티픽솔루션스 유한회사)

           

          주소 : 서울시 강남구 광평로 281 수서오피스빌딩 12층 06349 | 통신판매업신고번호 : 2015-서울강남-00898

          ISMS Logo

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-fbg7s:80/100.66.79.246:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline