Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___7466543_10
          See other ABCC4 GT Assays ›
          SNP ID:
          rs997777
          Gene
          ABCC4
          Gene Name
          ATP binding cassette subfamily C member 4
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.13: 95141200 - 95141200 on Build GRCh38
          Polymorphism:
          A/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          GAAAGGAGTAAAAGAGCTTTAATCC[A/T]CTGACATTACAAGTCGGAGGCAAAG

          Assay ID C___7466543_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605250

          Literature Links:

          ABCC4 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.46)
          (0.54)
          Caucasian
          A (0.36)
          (0.64)
          CEPH (CEU)
          A (0.31)
          (0.69)
          EAS
          A (0.38)
          (0.62)
          African American
          T (0.21)
          (0.79)
          YRI (Yoruba)
          T (0.19)
          (0.81)
          SAS
          A (0.34)
          (0.66)
          Chinese - Not Available JPT (Japanese)
          A (0.42)
          (0.58)
          AFR
          T (0.22)
          (0.78)
          Japanese - Not Available CHB (Han Chinese)
          A (0.36)
          (0.64)
          EUR
          A (0.30)
          (0.70)
          AMR
          A (0.38)
          (0.62)
          ABCC4 - ATP binding cassette subfamily C member 4
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001105515.2 Intron NP_001098985.1
          NM_001301829.1 Intron NP_001288758.1
          NM_001301830.1 Intron NP_001288759.1
          NM_005845.4 Intron NP_005836.2
          XM_005254025.2 Intron XP_005254082.1
          XM_017020319.1 Intron XP_016875808.1
          XM_017020320.1 Intron XP_016875809.1
          XM_017020321.1 Intron XP_016875810.1
          XM_017020322.1 Intron XP_016875811.1

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Panther Classification:

          Molecular Function -

          ATP-binding cassette (ABC) transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          platelet degranulation
          biological_process
          prostaglandin secretion
          cilium assembly
          transmembrane transport
          oxidation-reduction process
          anion transmembrane transport
          ATP binding
          ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism
          15-hydroxyprostaglandin dehydrogenase (NAD+) activity
          anion transmembrane-transporting ATPase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7b6576f7bc-t4kr2:80/100.66.77.141:80.
          git-commit: 6d309ebe7a31b2ceadeb87f43b473eebab110cf3
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-2026.03.11-1.0