Hamburger Menu Button
Thermo Fisher Scientific Logo
登入
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Tubes
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Clinical Genomics
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO 和 CRO 服務
    • CDMO 服務
    • 臨床試驗 CRO 服務
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • Register for an Account
    • How to Order
    • Instrument Support
    • Technical Support Centers
    • Learning Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • 快速訂購
          • 登入
            登入
            Don't have an account ? Create Account
            • 帳戶
            • 訂單
            • 訂製產品與專案
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___7486664_20
          See other DRD2 GT Assays ›
          SNP ID:
          rs1124491
          Gene
          DRD2
          Gene Name
          dopamine receptor D2
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.11: 113411368 - 113411368 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CCAAGGTCATTCACTCTTGAGCAGC[A/G]AGGCTGAGAGCTGAACTCCGGTCTA

          Assay ID C___7486664_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 126450

          Literature Links:

          DRD2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.20)
          (0.80)
          Caucasian - Not Available CEPH (CEU)
          A (0.16)
          (0.84)
          EAS
          A (0.40)
          (0.60)
          African American - Not Available YRI (Yoruba)
          A (0.01)
          (0.99)
          SAS
          A (0.26)
          (0.74)
          Chinese - Not Available JPT (Japanese)
          A (0.40)
          (0.60)
          AFR
          A (0.02)
          (0.98)
          Japanese - Not Available CHB (Han Chinese)
          A (0.48)
          (0.52)
          EUR
          A (0.15)
          (0.85)
          AMR
          A (0.26)
          (0.74)
          DRD2 - dopamine receptor D2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000795.3 Intron NP_000786.1
          NM_016574.3 Intron NP_057658.2
          XM_017017296.1 Intron XP_016872785.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          G-protein coupled receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          temperature homeostasis
          response to hypoxia
          synaptic transmission, dopaminergic
          response to amphetamine
          neurological system process involved in regulation of systemic arterial blood pressure
          regulation of heart rate
          regulation of sodium ion transport
          G-protein coupled receptor internalization
          positive regulation of neuroblast proliferation
          positive regulation of receptor internalization
          negative regulation of adenylate cyclase activity
          adenylate cyclase-inhibiting dopamine receptor signaling pathway
          neuron-neuron synaptic transmission
          axonogenesis
          synapse assembly
          sensory perception of smell
          long-term memory
          grooming behavior
          locomotory behavior
          adult walking behavior
          feeding behavior
          protein localization
          negative regulation of cell proliferation
          associative learning
          visual learning
          response to light stimulus
          response to toxic substance
          response to iron ion
          regulation of dopamine secretion
          response to inactivity
          Wnt signaling pathway
          striatum development
          orbitofrontal cortex development
          cerebral cortex GABAergic interneuron migration
          adenohypophysis development
          negative regulation of cell migration
          peristalsis
          regulation of cAMP metabolic process
          auditory behavior
          activation of protein kinase activity
          regulation of synaptic transmission, GABAergic
          positive regulation of cytokinesis
          circadian regulation of gene expression
          negative regulation of dopamine secretion
          response to histamine
          response to nicotine
          positive regulation of urine volume
          positive regulation of renal sodium excretion
          positive regulation of multicellular organism growth
          response to cocaine
          negative regulation of circadian sleep/wake cycle, sleep
          dopamine metabolic process
          response to drug
          regulation of potassium ion transport
          response to morphine
          pigmentation
          regulation of phosphoprotein phosphatase activity
          positive regulation of G-protein coupled receptor protein signaling pathway
          negative regulation of blood pressure
          negative regulation of innate immune response
          positive regulation of transcription from RNA polymerase II promoter
          phosphatidylinositol metabolic process
          negative regulation of insulin secretion
          acid secretion
          behavioral response to cocaine
          behavioral response to ethanol
          regulation of long-term neuronal synaptic plasticity
          response to axon injury
          branching morphogenesis of a nerve
          arachidonic acid secretion
          negative regulation of protein secretion
          release of sequestered calcium ion into cytosol
          negative regulation of cytosolic calcium ion concentration
          regulation of dopamine uptake involved in synaptic transmission
          positive regulation of dopamine uptake involved in synaptic transmission
          regulation of synapse structural plasticity
          negative regulation of protein kinase B signaling
          negative regulation of synaptic transmission, glutamatergic
          positive regulation of growth hormone secretion
          prepulse inhibition
          phospholipase C-activating dopamine receptor signaling pathway
          negative regulation of dopamine receptor signaling pathway
          positive regulation of ERK1 and ERK2 cascade
          adenylate cyclase-activating adrenergic receptor signaling pathway
          regulation of locomotion involved in locomotory behavior
          chemical synaptic transmission, postsynaptic
          positive regulation of glial cell-derived neurotrophic factor secretion
          positive regulation of long-term synaptic potentiation
          negative regulation of voltage-gated calcium channel activity
          dopamine neurotransmitter receptor activity, coupled via Gi/Go
          adrenergic receptor activity
          protein binding
          drug binding
          dopamine binding
          ionotropic glutamate receptor binding
          identical protein binding
          protein homodimerization activity
          protein heterodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Hong Kong flag icon
          Hong Kong

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline