Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___7514879_10
          See other LOC100287329 GT Assays ›
          SNP ID:
          rs1800629
          Gene
          LOC100287329 LTA LTB TNF
          Gene Name
          uncharacterized LOC100287329
          lymphotoxin alpha
          lymphotoxin beta
          tumor necrosis factor
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.6: 31575254 - 31575254 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          GAGGCAATAGGTTTTGAGGGGCATG[A/G]GGACGGGGTTCAGCCTCCAGGGTCC

          Assay ID C___7514879_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 153440 MIM: 600978 MIM: 191160

          Literature Links:

          LOC100287329 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.09)
          (0.91)
          Caucasian - Not Available CEPH (CEU)
          A (0.17)
          (0.83)
          EAS
          A (0.06)
          (0.94)
          African American - Not Available YRI (Yoruba)
          A (0.09)
          (0.91)
          SAS
          A (0.05)
          (0.95)
          Japanese
          A (0.00)
          (1.00)
          JPT (Japanese)
          A (0.02)
          (0.98)
          AFR
          A (0.12)
          (0.88)
          Chinese
          A (0.14)
          (0.86)
          CHB (Han Chinese)
          A (0.04)
          (0.96)
          EUR
          A (0.13)
          (0.87)
          AMR
          A (0.07)
          (0.93)
          LOC100287329 - uncharacterized LOC100287329
          There are no transcripts associated with this gene.
          LTA - lymphotoxin alpha
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000595.3 Intron NP_000586.2
          NM_001159740.2 Intron NP_001153212.1
          XM_011514615.2 Intron XP_011512917.1
          XM_011514616.2 Intron XP_011512918.1
          XM_011514617.2 Intron XP_011512919.1
          XM_011514618.1 Intron XP_011512920.1
          LTB - lymphotoxin beta
          There are no transcripts associated with this gene.
          TNF - tumor necrosis factor
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000594.3 Intron NP_000585.2

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Gene Ontology Categories:

          Function(s) Process(es)

          response to hypoxia
          positive regulation of chronic inflammatory response to antigenic stimulus
          positive regulation of humoral immune response mediated by circulating immunoglobulin
          apoptotic process
          humoral immune response
          signal transduction
          cell-cell signaling
          response to nutrient
          response to lipopolysaccharide
          positive regulation of interferon-gamma production
          tumor necrosis factor-mediated signaling pathway
          response to drug
          positive regulation of apoptotic process
          negative regulation of growth of symbiont in host
          negative regulation of fibroblast proliferation
          lymph node development
          defense response to Gram-positive bacterium
          positive regulation of glial cell proliferation
          protein import into nucleus, translocation
          negative regulation of transcription from RNA polymerase II promoter
          MAPK cascade
          activation of MAPKKK activity
          activation of MAPK activity
          positive regulation of cytokine production
          positive regulation of protein phosphorylation
          chronic inflammatory response to antigenic stimulus
          negative regulation of cytokine secretion involved in immune response
          glucose metabolic process
          activation of cysteine-type endopeptidase activity involved in apoptotic process
          inflammatory response
          I-kappaB kinase/NF-kappaB signaling
          JNK cascade
          extrinsic apoptotic signaling pathway via death domain receptors
          intrinsic apoptotic signaling pathway in response to DNA damage
          response to virus
          response to salt stress
          positive regulation of gene expression
          negative regulation of gene expression
          negative regulation of alkaline phosphatase activity
          regulation of tumor necrosis factor-mediated signaling pathway
          negative regulation of lipid storage
          extracellular matrix organization
          osteoclast differentiation
          sequestering of triglyceride
          cortical actin cytoskeleton organization
          positive regulation of protein complex assembly
          positive regulation of fever generation
          lipopolysaccharide-mediated signaling pathway
          negative regulation of interleukin-6 production
          positive regulation of chemokine production
          positive regulation of interleukin-6 production
          positive regulation of interleukin-8 production
          receptor biosynthetic process
          positive regulation of peptidyl-serine phosphorylation
          positive regulation of heterotypic cell-cell adhesion
          negative regulation of myosin-light-chain-phosphatase activity
          positive regulation of NF-kappaB import into nucleus
          positive regulation of programmed cell death
          regulation of I-kappaB kinase/NF-kappaB signaling
          positive regulation of I-kappaB kinase/NF-kappaB signaling
          negative regulation of protein complex disassembly
          positive regulation of protein complex disassembly
          positive regulation of cysteine-type endopeptidase activity involved in apoptotic process
          positive regulation of MAP kinase activity
          protein kinase B signaling
          positive regulation of JUN kinase activity
          negative regulation of viral genome replication
          positive regulation of chemokine biosynthetic process
          positive regulation of interleukin-8 biosynthetic process
          positive regulation of nitric oxide biosynthetic process
          negative regulation of fat cell differentiation
          negative regulation of myoblast differentiation
          negative regulation of osteoblast differentiation
          positive regulation of osteoclast differentiation
          positive regulation of cell adhesion
          positive regulation of protein kinase activity
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          positive regulation of translational initiation by iron
          negative regulation of glucose import
          embryonic digestive tract development
          positive regulation of smooth muscle cell proliferation
          positive regulation of cytokine secretion
          positive regulation of phagocytosis
          regulation of insulin secretion
          leukocyte tethering or rolling
          negative regulation of lipid catabolic process
          regulation of immunoglobulin secretion
          positive regulation of membrane protein ectodomain proteolysis
          positive regulation of sequence-specific DNA binding transcription factor activity
          positive regulation of NF-kappaB transcription factor activity
          positive regulation of protein transport
          response to glucocorticoid
          positive regulation of NFAT protein import into nucleus
          positive regulation of hair follicle development
          positive regulation of protein kinase B signaling
          positive regulation of vitamin D biosynthetic process
          positive regulation of calcidiol 1-monooxygenase activity
          epithelial cell proliferation involved in salivary gland morphogenesis
          regulation of branching involved in salivary gland morphogenesis
          negative regulation of branching involved in lung morphogenesis
          positive regulation of ERK1 and ERK2 cascade
          cellular response to amino acid stimulus
          cellular response to nicotine
          cellular response to organic cyclic compound
          death-inducing signaling complex assembly
          positive regulation of mononuclear cell migration
          positive regulation of podosome assembly
          establishment of protein localization to plasma membrane
          extrinsic apoptotic signaling pathway
          necroptotic signaling pathway
          positive regulation of NIK/NF-kappaB signaling
          positive regulation of superoxide dismutase activity
          regulation of establishment of endothelial barrier
          negative regulation of bicellular tight junction assembly
          positive regulation of leukocyte adhesion to vascular endothelial cell
          positive regulation of leukocyte adhesion to arterial endothelial cell
          positive regulation of protein localization to cell surface
          positive regulation of ceramide biosynthetic process
          positive regulation of blood microparticle formation
          positive regulation of chemokine (C-X-C motif) ligand 2 production
          negative regulation of extrinsic apoptotic signaling pathway in absence of ligand
          receptor binding
          cytokine activity
          tumor necrosis factor receptor binding
          protease binding
          protein binding
          identical protein binding
          transcription regulatory region DNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-fbg7s:80/100.66.79.246:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline