Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___7545093_10
          See other ACVR1 GT Assays ›
          SNP ID:
          rs12997
          Gene
          ACVR1
          Gene Name
          activin A receptor type 1
          Set Membership:
          > HapMap > Validated
          Chromosome Location:
          Chr.2: 157736845 - 157736845 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TAAAAATAAGCTTTAACATATGCAC[A/G]AAGCAGTTTTGTAAAAACTACTAAG

          Assay ID C___7545093_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 102576

          Literature Links:

          ACVR1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.43)
          (0.57)
          Caucasian
          G (0.24)
          (0.76)
          CEPH (CEU)
          C (0.27)
          (0.73)
          EAS
          C (0.29)
          (0.71)
          African American
          A (0.22)
          (0.78)
          YRI (Yoruba)
          T (0.04)
          (0.96)
          SAS
          C (0.19)
          (0.81)
          Japanese
          G (0.22)
          (0.78)
          JPT (Japanese)
          C (0.25)
          (0.75)
          AFR
          T (0.06)
          (0.94)
          Chinese
          G (0.32)
          (0.68)
          CHB (Han Chinese)
          C (0.29)
          (0.71)
          EUR
          C (0.27)
          (0.73)
          AMR
          C (0.25)
          (0.75)
          ACVR1 - activin A receptor type 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001105.4 2598 UTR 3 NP_001096.1
          NM_001111067.2 2598 UTR 3 NP_001104537.1
          XM_005246939.3 2598 UTR 3 XP_005246996.1
          XM_005246940.3 2598 UTR 3 XP_005246997.1
          XM_006712825.3 2598 UTR 3 XP_006712888.1
          XM_011512106.2 2598 UTR 3 XP_011510408.1
          XM_011512107.2 2598 UTR 3 XP_011510409.1
          XM_011512108.2 2598 UTR 3 XP_011510410.1

          Back To Top

          More Information


          Set Membership:

          HapMap Validated

          Panther Classification:

          Molecular Function -

          serine/threonine protein kinase receptor

          Gene Ontology Categories:

          Function(s) Process(es)

          G1/S transition of mitotic cell cycle
          patterning of blood vessels
          in utero embryonic development
          gastrulation with mouth forming second
          mesoderm formation
          neural crest cell migration
          acute inflammatory response
          embryonic heart tube morphogenesis
          outflow tract septum morphogenesis
          atrioventricular valve morphogenesis
          mitral valve morphogenesis
          endocardial cushion morphogenesis
          endocardial cushion fusion
          atrial septum primum morphogenesis
          protein phosphorylation
          transforming growth factor beta receptor signaling pathway
          germ cell development
          determination of left/right symmetry
          negative regulation of signal transduction
          positive regulation of pathway-restricted SMAD protein phosphorylation
          peptidyl-threonine phosphorylation
          signal transduction by protein phosphorylation
          regulation of ossification
          positive regulation of cell migration
          positive regulation of bone mineralization
          BMP signaling pathway
          activin receptor signaling pathway
          negative regulation of activin receptor signaling pathway
          positive regulation of osteoblast differentiation
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          smooth muscle cell differentiation
          pharyngeal system development
          pathway-restricted SMAD protein phosphorylation
          ventricular septum morphogenesis
          cardiac muscle cell fate commitment
          BMP signaling pathway involved in heart development
          endocardial cushion cell fate commitment
          cellular response to glucocorticoid stimulus
          cellular response to BMP stimulus
          positive regulation of epithelial to mesenchymal transition involved in endocardial cushion formation
          positive regulation of determination of dorsal identity
          negative regulation of extrinsic apoptotic signaling pathway
          protein kinase activity
          protein serine/threonine kinase activity
          transmembrane receptor protein serine/threonine kinase activity
          receptor signaling protein serine/threonine kinase activity
          transforming growth factor beta receptor activity, type I
          protein binding
          ATP binding
          activin receptor activity, type I
          peptide hormone binding
          protein homodimerization activity
          SMAD binding
          metal ion binding
          activin binding
          transforming growth factor beta binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-x75fr:80/100.66.77.4:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline