Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___7577218_10
          See other GSN GT Assays ›
          SNP ID:
          rs957295
          Gene
          GSN GSN-AS1
          Gene Name
          gelsolin
          GSN antisense RNA 1
          Set Membership:
          -
          Chromosome Location:
          Chr.9: 121280396 - 121280396 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          GGGCACATGCCATGCTGAAGCTTTA[A/G]AGGTGAAGCAGACAGAATCCTTGCC

          Assay ID C___7577218_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 137350

          Literature Links:

          GSN PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          GSN - gelsolin
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000177.4 Intron NP_000168.1
          NM_001127662.1 Intron NP_001121134.1
          NM_001127663.1 Intron NP_001121135.2
          NM_001127664.1 Intron NP_001121136.1
          NM_001127665.1 Intron NP_001121137.1
          NM_001127666.1 Intron NP_001121138.1
          NM_001127667.1 Intron NP_001121139.1
          NM_001258029.1 Intron NP_001244958.1
          NM_001258030.1 Intron NP_001244959.1
          NM_198252.2 Intron NP_937895.1
          XM_005251943.1 Intron XP_005252000.1
          XM_005251944.1 Intron XP_005252001.1
          XM_005251945.3 Intron XP_005252002.1
          XM_006717079.1 Intron XP_006717142.1
          XM_011518584.1 Intron XP_011516886.1
          XM_011518585.1 Intron XP_011516887.1
          XM_011518586.1 Intron XP_011516888.1
          XM_011518587.2 Intron XP_011516889.1
          XM_011518588.2 Intron XP_011516890.1
          XM_011518589.2 Intron XP_011516891.1
          XM_011518590.2 Intron XP_011516892.1
          XM_011518591.2 Intron XP_011516893.1
          XM_011518592.1 Intron XP_011516894.1
          XM_011518593.1 Intron XP_011516895.1
          XM_011518594.1 Intron XP_011516896.1
          XM_017014643.1 Intron XP_016870132.1
          XM_017014644.1 Intron XP_016870133.1
          XM_017014645.1 Intron XP_016870134.1
          XM_017014646.1 Intron XP_016870135.1
          XM_017014647.1 Intron XP_016870136.1
          XM_017014648.1 Intron XP_016870137.1
          GSN-AS1 - GSN antisense RNA 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          non-motor actin binding protein

          Gene Ontology Categories:

          Function(s) Process(es)

          phagocytosis, engulfment
          aging
          positive regulation of gene expression
          oligodendrocyte development
          striated muscle atrophy
          extracellular matrix disassembly
          actin filament polymerization
          protein destabilization
          tissue regeneration
          sequestering of actin monomers
          cellular protein metabolic process
          actin nucleation
          response to ethanol
          negative regulation of viral entry into host cell
          phosphatidylinositol-mediated signaling
          actin filament severing
          barbed-end actin filament capping
          positive regulation of actin nucleation
          response to folic acid
          actin filament capping
          cilium morphogenesis
          cellular response to cadmium ion
          regulation of podosome assembly
          actin filament reorganization
          renal protein absorption
          hepatocyte apoptotic process
          positive regulation of keratinocyte apoptotic process
          regulation of wound healing, spreading of epidermal cells
          regulation of establishment of T cell polarity
          regulation of plasma membrane raft polarization
          regulation of receptor clustering
          positive regulation of protein processing in phagocytic vesicle
          amyloid fibril formation
          positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway
          actin binding
          calcium ion binding
          protein binding
          protein domain specific binding
          myosin II binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-9fm2r:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline