Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___7606665_20
          See other RPA3 GT Assays ›
          SNP ID:
          rs886725
          Gene
          RPA3 UMAD1
          Gene Name
          replication protein A3
          UBAP1-MVB12-associated (UMA) domain containing 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.7: 7668371 - 7668371 on Build GRCh38
          Polymorphism:
          A/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          TACTTATGGCAACTAAGTAAAAAAA[A/T]TTATGAGTACAGTACTATAAGGTTT

          Assay ID C___7606665_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 179837

          Literature Links:

          RPA3 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.38)
          (0.62)
          Caucasian - Not Available CEPH (CEU)
          A (0.39)
          (0.61)
          EAS
          A (0.22)
          (0.78)
          African American - Not Available YRI (Yoruba)
          A (0.42)
          (0.58)
          SAS
          T (0.43)
          (0.57)
          Chinese - Not Available JPT (Japanese)
          A (0.22)
          (0.78)
          AFR
          T (0.48)
          (0.52)
          Japanese - Not Available CHB (Han Chinese)
          T (0.17)
          (0.83)
          EUR
          T (0.39)
          (0.61)
          AMR
          A (0.36)
          (0.64)
          RPA3 - replication protein A3
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_002947.4 Intron NP_002938.1
          UMAD1 - UBAP1-MVB12-associated (UMA) domain containing 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001302348.1 Intron NP_001289277.1
          NM_001302349.1 Intron NP_001289278.1
          NM_001302350.1 Intron NP_001289279.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          G1/S transition of mitotic cell cycle
          telomere maintenance via recombination
          double-strand break repair via homologous recombination
          DNA replication
          transcription-coupled nucleotide-excision repair
          base-excision repair
          nucleotide-excision repair
          nucleotide-excision repair, preincision complex stabilization
          nucleotide-excision repair, preincision complex assembly
          nucleotide-excision repair, DNA incision, 3'-to lesion
          nucleotide-excision repair, DNA incision, 5'-to lesion
          nucleotide-excision repair, DNA gap filling
          mismatch repair
          regulation of mitotic cell cycle
          translesion synthesis
          nucleotide-excision repair, DNA incision
          interstrand cross-link repair
          regulation of cell proliferation
          error-prone translesion synthesis
          DNA damage response, detection of DNA damage
          error-free translesion synthesis
          regulation of cellular response to heat
          regulation of signal transduction by p53 class mediator
          damaged DNA binding
          single-stranded DNA binding
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7d94cb4b65-6wvps:80/100.66.75.98:80.
          git-commit: c9e08c96761173abe34e68f880379696776a4827
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.44.1-2026.02.97.1.0