Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Inspección de seguridad alimentaria Servicios
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • A quiénes brindamos nuestros servicios
    • Industria biotecnológica
    • Sector biofarmacéutico
    • CDMO
    • Diagnósticos de laboratorio
    • Ciencias aplicadas e industriales
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Estatus del pedido
            • Productos personalizados y proyectos​
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___8700973_10
          See other HMGA2 GT Assays ›
          SNP ID:
          rs883605
          Gene
          HMGA2
          Gene Name
          high mobility group AT-hook 2
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.12: 65961238 - 65961238 on Build GRCh38
          Polymorphism:
          A/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          GAATGAGAAGTGAATCATCTGGGGA[A/C]AAACGAGGTGTGTATCTGCCTAACA

          Assay ID C___8700973_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 600698

          Literature Links:

          HMGA2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.03)
          (0.97)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba)
          T (0.12)
          (0.88)
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.10)
          (0.90)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.01)
          (0.99)
          HMGA2 - high mobility group AT-hook 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001300918.1 Intron NP_001287847.1
          NM_001300919.1 Intron NP_001287848.1
          NM_003483.4 Intron NP_003474.1
          NM_003484.1 Intron NP_003475.1
          XM_017019989.1 Intron XP_016875478.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          endodeoxyribonuclease

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          epithelial to mesenchymal transition
          chondrocyte differentiation
          mesodermal-endodermal cell signaling
          base-excision repair
          chromatin organization
          regulation of transcription, DNA-templated
          transcription from RNA polymerase II promoter
          mitotic nuclear division
          mitotic G2 DNA damage checkpoint
          multicellular organism development
          response to virus
          regulation of cell cycle process
          positive regulation of gene expression
          chromosome condensation
          chromosome breakage
          heterochromatin assembly
          histone H2A-S139 phosphorylation
          senescence-associated heterochromatin focus assembly
          endodermal cell differentiation
          chondrocyte proliferation
          regulation of growth
          DNA damage response, detection of DNA damage
          positive regulation of apoptotic process
          negative regulation of apoptotic process
          negative regulation of DNA binding
          negative regulation by host of viral transcription
          fat cell differentiation
          negative regulation of single stranded viral RNA replication via double stranded DNA intermediate
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          mesodermal cell differentiation
          mesenchymal cell differentiation
          stem cell differentiation
          cell division
          positive regulation of cell cycle arrest
          oncogene-induced cell senescence
          regulation of stem cell population maintenance
          positive regulation of stem cell proliferation
          positive regulation of transcription regulatory region DNA binding
          positive regulation of cellular response to X-ray
          positive regulation of cellular senescence
          positive regulation of response to DNA damage stimulus
          negative regulation of double-strand break repair via nonhomologous end joining
          regulation of cellular response to drug
          regulatory region DNA binding
          transcription factor activity, transcription factor binding
          core promoter binding
          transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding
          transcriptional repressor activity, RNA polymerase II core promoter proximal region sequence-specific binding
          DNA binding
          AT DNA binding
          DNA-(apurinic or apyrimidinic site) lyase activity
          DNA-dependent protein kinase activity
          protein binding
          transcription factor binding
          DNA binding, bending
          nucleosomal DNA binding
          cAMP response element binding
          MH2 domain binding
          MH1 domain binding
          SMAD binding
          5'-deoxyribose-5-phosphate lyase activity
          C2H2 zinc finger domain binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-9fm2r:80/100.66.79.29:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline