Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___8708707_10
          See other DEDD2 GT Assays ›
          SNP ID:
          rs1044232
          Gene
          DEDD2 POU2F2
          Gene Name
          death effector domain containing 2
          POU class 2 homeobox 2
          Set Membership:
          -
          Chromosome Location:
          Chr.19: 42198691 - 42198691 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CAAAGCCTTTGCATTCCCTTTCCAA[A/G]AAGGTGGCTGTTTACTGGTTTTGGC

          Assay ID C___8708707_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 164176

          Literature Links:

          DEDD2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          DEDD2 - death effector domain containing 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001270614.1 1873 UTR 3 NP_001257543.1
          NM_001270615.1 1873 UTR 3 NP_001257544.1
          NM_133328.3 1873 UTR 3 NP_579874.1
          XM_011526569.1 1873 UTR 3 XP_011524871.1
          XM_011526571.1 1873 UTR 3 XP_011524873.1
          XM_011526572.1 1873 UTR 3 XP_011524874.1
          XM_017026402.1 1873 UTR 3 XP_016881891.1
          XM_017026403.1 1873 UTR 3 XP_016881892.1
          POU2F2 - POU class 2 homeobox 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001207025.2 1873 Intron NP_001193954.1
          NM_001207026.1 1873 Intron NP_001193955.1
          NM_001247994.1 1873 Intron NP_001234923.1
          NM_002698.4 1873 Intron NP_002689.1
          XM_005259010.3 1873 Intron XP_005259067.1
          XM_011527040.2 1873 Intron XP_011525342.1
          XM_011527041.2 1873 Intron XP_011525343.1
          XM_011527042.2 1873 Intron XP_011525344.1
          XM_011527043.2 1873 Intron XP_011525345.2
          XM_017026884.1 1873 Intron XP_016882373.1
          XM_017026885.1 1873 Intron XP_016882374.1
          XM_017026886.1 1873 Intron XP_016882375.1
          XM_017026887.1 1873 Intron XP_016882376.1
          XM_017026888.1 1873 Intron XP_016882377.1
          XM_017026889.1 1873 Intron XP_016882378.1
          XM_017026890.1 1873 Intron XP_016882379.1
          XM_017026891.1 1873 Intron XP_016882380.1
          XM_017026892.1 1873 Intron XP_016882381.1
          XM_017026893.1 1873 Intron XP_016882382.1
          XM_017026894.1 1873 Intron XP_016882383.1
          XM_017026895.1 1873 Intron XP_016882384.1
          XM_017026896.1 1873 Intron XP_016882385.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          transcription, DNA-templated
          RNA processing
          extrinsic apoptotic signaling pathway via death domain receptors
          rRNA catabolic process
          cellular homeostasis
          apoptotic nuclear changes
          intracellular signal transduction
          negative regulation of transcription, DNA-templated
          positive regulation of extrinsic apoptotic signaling pathway
          mature B cell differentiation
          immunoglobulin secretion involved in immune response
          transcription from RNA polymerase II promoter
          humoral immune response
          snRNA transcription from RNA polymerase II promoter
          positive regulation of transcription from RNA polymerase II promoter
          cell maturation
          DNA binding
          protein binding
          receptor signaling complex scaffold activity
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding
          transcription factor activity, sequence-specific DNA binding
          protein domain specific binding
          sequence-specific DNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-7d94cb4b65-jwmpg:80/100.66.76.145:80.
          git-commit: c9e08c96761173abe34e68f880379696776a4827
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.44.1-2026.02.97.1.0